Ham’s F12 phenol free, 6x500ml

Ham’s F12 phenol free, 6x500ml

To Order Now: info@anbioq.org

Ham's F-10 With L-glutamine W/O phenol red.

HFL08-6X500ML 6 x 500 ml
EUR 196
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine without phenol red.

Ham's F-12 W/O D-Glucose, L-Glutamine, and Phenol Red.

HFL10-6X500ML 6 x 500 ml
EUR 205
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without D-Glucose, L-Glutamine, and Phenol Red.

Ham's F-12 (Kaighn's Modification) With L-glutamine. W/O phenol red.

HFL12-6X500ML 6 x 500 ml
EUR 153
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red.

Ham's F-12 With L-glutamine. W/O phenol red, lipoic acid and linoleic acid.

HFL11-6X500ML 6 x 500 ml
EUR 282
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red, lipoic acid and linoleic acid.

Ham's F-10 With L-glutamine.

HFL01-6X500ML 6 x 500 ml
EUR 116
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine.

Ham's F-12 With L-glutamine.

HFL04-6X500ML 6 x 500 ml
EUR 123
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine.

Ham's F-10 W/O L-glutamine.

HFL09-6X500ML 6 x 500 ml
EUR 205
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: Without L-glutamine.

Ham's F-12 (Kaighn's Modification) With L-glutamine

HFL06-6X500ML 6 x 500 ml
EUR 144
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine

Ham's F12, 1X, with 1.00 mM L-Glutamine

CCM1245-500 500 mL
EUR 65.46
  • Product category: Culture Media

Ham's F-10 With L-glutamine and 25mM HEPES buffer.

HFL02-6X500ML 500 ml
EUR 206
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine and 25mM HEPES buffer.

DMEM/F-12 With L-glutamine. No phenol red.

DFL16-6X500ML 6 x 500 ml
EUR 124
  • Product line: Animal Cell Culture Media
  • Product family: DMEM / Ham's F-12
Description: With L-glutamine. No phenol red.

Ham's F-12 With L-glutamine. No phenol red.

HFL05-500ML 500 ml
EUR 75
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. No phenol red.

Human Free PSA (f-PSA) ELISA Kit

PRB-5049-FREE 96 assays
EUR 572

E199 With Earle's salts and L-glutamine. No phenol red.

MDL06-6X500ML 6 x 500 ml
EUR 298
  • Product line: Animal Cell Culture Media
  • Product family: Medium 199
Description: With Earle's salts and L-glutamine. No phenol red.

Human Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Hu-48T 48T
EUR 479
  • Should the Human Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor XII (F12) in samples from plasma.

Human Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Hu-96T 96T
EUR 621
  • Should the Human Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor XII (F12) in samples from plasma.

Mouse Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Mu-48T 48T
EUR 489
  • Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.

Mouse Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Mu-96T 96T
EUR 635
  • Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.

Human Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Hu-48Tests 48 Tests
EUR 500

Human Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Hu-96Tests 96 Tests
EUR 692

Mouse Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Mu-48Tests 48 Tests
EUR 511

Mouse Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Mu-96Tests 96 Tests
EUR 709

Human Coagulation Factor XII (F12) ELISA Kit

RD-F12-Hu-48Tests 48 Tests
EUR 478

Human Coagulation Factor XII (F12) ELISA Kit

RD-F12-Hu-96Tests 96 Tests
EUR 662

Mouse Coagulation Factor XII (F12) ELISA Kit

RD-F12-Mu-48Tests 48 Tests
EUR 489

Mouse Coagulation Factor XII (F12) ELISA Kit

RD-F12-Mu-96Tests 96 Tests
EUR 677

IMDM With L-glutamine and 25 mM HEPES. No Phenol Red.

IML01-6X500ML 6 x 500 ml
EUR 134
  • Product line: Animal Cell Culture Media
  • Product family: Iscove's Modified DMEM
Description: With L-glutamine and 25 mM HEPES. No Phenol Red.

IMDM With L-glutamine and 25 mM HEPES. With Phenol Red.

IML02-6X500ML 6 x 500 ml
EUR 119
  • Product line: Animal Cell Culture Media
  • Product family: Iscove's Modified DMEM
Description: With L-glutamine and 25 mM HEPES. With Phenol Red.

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-050 500ml
EUR 88

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-300 6x500ml
EUR 165

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-310 10x500ml
EUR 219

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-320 20x500ml
EUR 340

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-350 50x500ml
EUR 585

Ham's F-12 W/O L-glutamine and phenol red.

HFL07-500ML 500 ml
EUR 79
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine and phenol red.

Ham's F-10 With L-glutamine W/O phenol red.

HFL08-500ML 500 ml
EUR 88
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine without phenol red.

DMEM/F-12 With L-glutamine and 15mM HEPES. No phenol red.

DFL14-6X500ML 6 x 500 ml
EUR 138
  • Product line: Animal Cell Culture Media
  • Product family: DMEM / Ham's F-12
Description: With L-glutamine and 15mM HEPES. No phenol red.

McCoy's 5A With L-Glutamine. W/O Phenol Red. (Iwakata & Grace Modification)

MCL06-6X500ML 6 x 500 ml
EUR 216
  • Product line: Animal Cell Culture Media
  • Product family: McCoy's 5A Media
Description: With L-Glutamine. Without Phenol Red. (Iwakata & Grace Modification)

DMEM (LG) With low-glucose, L-glutamine and sodium pyruvate. W/O phenol red.

DML06-6X500ML 6 x 500 ml
EUR 132
  • Product line: Animal Cell Culture Media
  • Product family: Dulbecco's Modified Eagle Medium
Description: With low-glucose, L-glutamine and sodium pyruvate. Without phenol red.

DMEM (HG) With high-glucose. W/O L-glutamine, sodium pyruvate and phenol red.

DML20-6X500ML 6 x 500 ml
EUR 128
  • Product line: Animal Cell Culture Media
  • Product family: Dulbecco's Modified Eagle Medium
Description: With high-glucose. Without L-glutamine, sodium pyruvate and phenol red.

DMEM (HG) With high glucose , sodium pyruvate and L-glutamine. W/O phenol red.

DML41-6X500ML 6 x 500 ml
EUR 106
  • Product line: Animal Cell Culture Media
  • Product family: Dulbecco's Modified Eagle Medium
Description: With high glucose , sodium pyruvate and L-glutamine. Without phenol red.

Human Free PSA (f-PSA) ELISA Kit

PRB-5049-FREE-5 5 x 96 assays
EUR 2283

DMEM (LG) With low-glucose and sodium pyruvate. W/O L-glutamine and phenol red.

DML34-6X500ML 6 x 500 ml
EUR 143
  • Product line: Animal Cell Culture Media
  • Product family: Dulbecco's Modified Eagle Medium
Description: With low-glucose and sodium pyruvate. Without L-glutamine and phenol red.

DMEM/F-12 With sodium pyruvate. W/O Glucose, L-glutamine, HEPES and Phenol Red.

DFL23-6X500ML 6 x 500 ml
EUR 262
  • Product line: Animal Cell Culture Media
  • Product family: DMEM / Ham's F-12
Description: With sodium pyruvate. Without Glucose, L-glutamine, HEPES and Phenol Red.

DMEM (W/O Glucose) With L-glutamine. W/O D-glucose, phenol red and sodium pyruvate.

DML37-6X500ML 6 x 500 ml
EUR 216
  • Product line: Animal Cell Culture Media
  • Product family: Dulbecco's Modified Eagle Medium
Description: With L-glutamine. Without D-glucose, phenol red and sodium pyruvate.

DMEM (LG) With low glucose. W/O L-glutamine, L-cystine, L-methionine and phenol red.

DML55-6X500ML 6 x 500 ml
EUR 298
  • Product line: Animal Cell Culture Media
  • Product family: Dulbecco's Modified Eagle Medium
Description: With low glucose. Without L-glutamine, L-cystine, L-methionine and phenol red.

DMEM/F-12 With L-glutamine and 15mM HEPES. W/O choline chloride and phenol red.

DFL25-6X500ML 6 x 500 ml
EUR 300
  • Product line: Animal Cell Culture Media
  • Product family: DMEM / Ham's F-12
Description: With L-glutamine and 15mM HEPES. Without choline chloride and phenol red.

DMEM (HG) With high-glucose, L-glutamine, and 25mM HEPES. W/O sodium pyruvate and phenol red.

DML12-6X500ML 6 x 500 ml
EUR 145
  • Product line: Animal Cell Culture Media
  • Product family: Dulbecco's Modified Eagle Medium
Description: With high-glucose, L-glutamine, and 25mM HEPES. Without sodium pyruvate and phenol red.

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-050 500ml
EUR 85

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-300 6x500ml
EUR 165

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-310 10x500ml
EUR 219

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-320 20x500ml
EUR 340

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-350 50x500ml
EUR 585

Ham's F-12 W/O D-Glucose, L-Glutamine, and Phenol Red.

HFL10-500ML 500 ml
EUR 90
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without D-Glucose, L-Glutamine, and Phenol Red.

Ham's F-12 (Kaighn's Modification) With L-glutamine. W/O phenol red.

HFL12-500ML 500 ml
EUR 81
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.

HFP10-10LT 10 L
EUR 75
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.

HFP10-10X1LT 10 x 1 L
EUR 83
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.

HFP10-50LT 50 L
EUR 107
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

Phenol

20-abx184753
  • EUR 244.00
  • EUR 217.00
  • 1 kg
  • 500 g
  • Shipped within 1-2 weeks.

F12/ Rat F12 ELISA Kit

ELI-02419r 96 Tests
EUR 886

CORNING® MATRIGEL® MATRIX HIGH CONCENTRATION (HC), PHENOL-RED FREE *LDEV-FREE, 10ML

354262 1/pk
EUR 761
Description: Advanced Cells - DL; ECM - DL

F12 antibody

70R-17186 50 ul
EUR 435
Description: Rabbit polyclonal F12 antibody

F12 Antibody

32389-100ul 100ul
EUR 252

F12 Antibody

DF6558 200ul
EUR 304
Description: F12 Antibody detects endogenous levels of total F12.

F12 Antibody

1-CSB-PA007918GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

F12 Antibody

1-CSB-PA007918LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

F12 Antibody

1-CSB-PA007918LA01PI
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is Unconjugated. Tested in the following application: ELISA

F12 siRNA

20-abx901805
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F12 siRNA

20-abx915867
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F12 siRNA

20-abx915868
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F12 Antibody

ABD6558 100 ug
EUR 438

Ham's F-12 With L-glutamine. W/O phenol red, lipoic acid and linoleic acid.

HFL11-500ML 500 ml
EUR 104
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red, lipoic acid and linoleic acid.

CORNING® MATRIGEL® BASEMENT MEMBRANE MATRIX, PHENOL RED-FREE, 10ML

356237 1/pk
EUR 516
Description: Advanced Cells - DL; ECM - DL

Nonyl Phenol

AT037 1mg
EUR 1368

Water Phenol

abx082109-250ml 250 ml
EUR 189
  • Shipped within 5-10 working days.

Nonyl Phenol

AG037 1 mg
EUR 523

Phenol Red

GT9844-100G 100 g
EUR 110

Phenol Red

GT9844-250G 250 g
EUR 181

Phenol Red

GT9844-25G 25 g
EUR 62

Phenol Red

GT9844-5G 5 g
EUR 46

Phenol, 99%

GK6990-100G 100 g
EUR 44

Phenol, 99%

GK6990-1KG 1 kg
EUR 78

Phenol, 99%

GK6990-500G 500 g
EUR 56

Phenol red

PB0420 25g
EUR 70.88
  • Product category: Culture Media/Indicators/Stains

Phenol, crystalline

PB4112 500g
EUR 175.28
  • Product category: Biochemicals/Misc. Biochemicals

SILAC - DMEM/F12

423 500 ml
EUR 99

SILAC- DMEM/F12

433 1L
EUR 88

F12 Blocking Peptide

DF6558-BP 1mg
EUR 195

F12 Conjugated Antibody

C32389 100ul
EUR 397

F12 cloning plasmid

CSB-CL007918HU-10ug 10ug
EUR 363
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 903
  • Sequence: atgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctcagtcccagaccccgggagccttgccggcgaagcgggagcagccgccttccctgaccaggaacggcccactgagctgcgggcagcggctccgcaagagtctgtcttcgatgacccgcgtcgt
  • Show more
Description: A cloning plasmid for the F12 gene.

F12 Rabbit pAb

A1691-100ul 100 ul
EUR 308

F12 Rabbit pAb

A1691-200ul 200 ul
EUR 459

F12 Rabbit pAb

A1691-20ul 20 ul
EUR 183

F12 Rabbit pAb

A1691-50ul 50 ul
EUR 223

pCMV-SPORT6-F12

PVT13753 2 ug
EUR 391

Anti-F12 antibody

STJ23595 100 µl
EUR 277
Description: This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged.

Phenol, 4-propoxy-

20-abx184303
  • EUR 523.00
  • EUR 286.00
  • 125g
  • 25 g
  • Shipped within 1-2 weeks.

2-(Aminomethyl)phenol

20-abx185699
  • EUR 314.00
  • EUR 1442.00
  • EUR 592.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.

Ham’s F12 phenol free, 6x500ml