Ham’s F12 phenol free, 6x500ml

Ham’s F12 phenol free, 6x500ml

To Order Now: info@anbioq.org

Ham's F-10 With L-glutamine W/O phenol red.
HFL08-6X500ML	Caisson Labs	6 x 500 ml	EUR 196
Product line: Animal Cell Culture Media Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine without phenol red.

Ham's F-12 W/O D-Glucose, L-Glutamine, and Phenol Red.
HFL10-6X500ML	Caisson Labs	6 x 500 ml	EUR 205
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: Without D-Glucose, L-Glutamine, and Phenol Red.

Ham's F-12 (Kaighn's Modification) With L-glutamine. W/O phenol red.
HFL12-6X500ML	Caisson Labs	6 x 500 ml	EUR 153
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red.

Ham's F-12 With L-glutamine. W/O phenol red, lipoic acid and linoleic acid.
HFL11-6X500ML	Caisson Labs	6 x 500 ml	EUR 282
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red, lipoic acid and linoleic acid.

Ham's F-10 With L-glutamine.
HFL01-6X500ML	Caisson Labs	6 x 500 ml	EUR 116
Product line: Animal Cell Culture Media Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine.

Ham's F-12 With L-glutamine.
HFL04-6X500ML	Caisson Labs	6 x 500 ml	EUR 123
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine.

Ham's F-10 W/O L-glutamine.
HFL09-6X500ML	Caisson Labs	6 x 500 ml	EUR 205
Product line: Animal Cell Culture Media Product family: Ham's F-10 Nutrient Mixtures
Description: Without L-glutamine.

Ham's F-12 (Kaighn's Modification) With L-glutamine
HFL06-6X500ML	Caisson Labs	6 x 500 ml	EUR 144
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine

Ham's F12, 1X, with 1.00 mM L-Glutamine
CCM1245-500	Bio Basic	500 mL	EUR 65.46
Product category: Culture Media

Ham's F-10 With L-glutamine and 25mM HEPES buffer.
HFL02-6X500ML	Caisson Labs	500 ml	EUR 206
Product line: Animal Cell Culture Media Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine and 25mM HEPES buffer.

DMEM/F-12 With L-glutamine. No phenol red.
DFL16-6X500ML	Caisson Labs	6 x 500 ml	EUR 124
Product line: Animal Cell Culture Media Product family: DMEM / Ham's F-12
Description: With L-glutamine. No phenol red.

Ham's F-12 With L-glutamine. No phenol red.
HFL05-500ML	Caisson Labs	500 ml	EUR 75
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. No phenol red.

Human Free PSA (f-PSA) ELISA Kit
PRB-5049-FREE	Cell Biolabs	96 assays	EUR 572

E199 With Earle's salts and L-glutamine. No phenol red.
MDL06-6X500ML	Caisson Labs	6 x 500 ml	EUR 298
Product line: Animal Cell Culture Media Product family: Medium 199
Description: With Earle's salts and L-glutamine. No phenol red.

Human Coagulation Factor XII (F12) ELISA Kit
DLR-F12-Hu-48T	DL Develop	48T	EUR 479
Should the Human Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor XII (F12) in samples from plasma.

Human Coagulation Factor XII (F12) ELISA Kit
DLR-F12-Hu-96T	DL Develop	96T	EUR 621
Should the Human Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor XII (F12) in samples from plasma.

Mouse Coagulation Factor XII (F12) ELISA Kit
DLR-F12-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.

Mouse Coagulation Factor XII (F12) ELISA Kit
DLR-F12-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.

Human Coagulation Factor XII (F12) ELISA Kit
RD-F12-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Coagulation Factor XII (F12) ELISA Kit
RD-F12-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Coagulation Factor XII (F12) ELISA Kit
RD-F12-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Coagulation Factor XII (F12) ELISA Kit
RD-F12-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Human Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Coagulation Factor XII (F12) ELISA Kit
RDR-F12-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

IMDM With L-glutamine and 25 mM HEPES. No Phenol Red.
IML01-6X500ML	Caisson Labs	6 x 500 ml	EUR 134
Product line: Animal Cell Culture Media Product family: Iscove's Modified DMEM
Description: With L-glutamine and 25 mM HEPES. No Phenol Red.

IMDM With L-glutamine and 25 mM HEPES. With Phenol Red.
IML02-6X500ML	Caisson Labs	6 x 500 ml	EUR 119
Product line: Animal Cell Culture Media Product family: Iscove's Modified DMEM
Description: With L-glutamine and 25 mM HEPES. With Phenol Red.

Ham's F-12 W/O L-glutamine and phenol red.
HFL07-500ML	Caisson Labs	500 ml	EUR 79
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine and phenol red.

Ham's F-10 With L-glutamine W/O phenol red.
HFL08-500ML	Caisson Labs	500 ml	EUR 88
Product line: Animal Cell Culture Media Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine without phenol red.

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red
CM018-050	GenDepot	500ml	EUR 88

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red
CM018-300	GenDepot	6x500ml	EUR 165

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red
CM018-310	GenDepot	10x500ml	EUR 219

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red
CM018-320	GenDepot	20x500ml	EUR 340

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red
CM018-350	GenDepot	50x500ml	EUR 585

DMEM/F-12 With L-glutamine and 15mM HEPES. No phenol red.
DFL14-6X500ML	Caisson Labs	6 x 500 ml	EUR 138
Product line: Animal Cell Culture Media Product family: DMEM / Ham's F-12
Description: With L-glutamine and 15mM HEPES. No phenol red.

McCoy's 5A With L-Glutamine. W/O Phenol Red. (Iwakata & Grace Modification)
MCL06-6X500ML	Caisson Labs	6 x 500 ml	EUR 216
Product line: Animal Cell Culture Media Product family: McCoy's 5A Media
Description: With L-Glutamine. Without Phenol Red. (Iwakata & Grace Modification)

DMEM (LG) With low-glucose, L-glutamine and sodium pyruvate. W/O phenol red.
DML06-6X500ML	Caisson Labs	6 x 500 ml	EUR 132
Product line: Animal Cell Culture Media Product family: Dulbecco's Modified Eagle Medium
Description: With low-glucose, L-glutamine and sodium pyruvate. Without phenol red.

DMEM (HG) With high-glucose. W/O L-glutamine, sodium pyruvate and phenol red.
DML20-6X500ML	Caisson Labs	6 x 500 ml	EUR 128
Product line: Animal Cell Culture Media Product family: Dulbecco's Modified Eagle Medium
Description: With high-glucose. Without L-glutamine, sodium pyruvate and phenol red.

DMEM (HG) With high glucose , sodium pyruvate and L-glutamine. W/O phenol red.
DML41-6X500ML	Caisson Labs	6 x 500 ml	EUR 106
Product line: Animal Cell Culture Media Product family: Dulbecco's Modified Eagle Medium
Description: With high glucose , sodium pyruvate and L-glutamine. Without phenol red.

Human Free PSA (f-PSA) ELISA Kit
PRB-5049-FREE-5	Cell Biolabs	5 x 96 assays	EUR 2283

DMEM/F-12 With sodium pyruvate. W/O Glucose, L-glutamine, HEPES and Phenol Red.
DFL23-6X500ML	Caisson Labs	6 x 500 ml	EUR 262
Product line: Animal Cell Culture Media Product family: DMEM / Ham's F-12
Description: With sodium pyruvate. Without Glucose, L-glutamine, HEPES and Phenol Red.

DMEM (LG) With low-glucose and sodium pyruvate. W/O L-glutamine and phenol red.
DML34-6X500ML	Caisson Labs	6 x 500 ml	EUR 143
Product line: Animal Cell Culture Media Product family: Dulbecco's Modified Eagle Medium
Description: With low-glucose and sodium pyruvate. Without L-glutamine and phenol red.

DMEM/F-12 With L-glutamine and 15mM HEPES. W/O choline chloride and phenol red.
DFL25-6X500ML	Caisson Labs	6 x 500 ml	EUR 300
Product line: Animal Cell Culture Media Product family: DMEM / Ham's F-12
Description: With L-glutamine and 15mM HEPES. Without choline chloride and phenol red.

DMEM (W/O Glucose) With L-glutamine. W/O D-glucose, phenol red and sodium pyruvate.
DML37-6X500ML	Caisson Labs	6 x 500 ml	EUR 216
Product line: Animal Cell Culture Media Product family: Dulbecco's Modified Eagle Medium
Description: With L-glutamine. Without D-glucose, phenol red and sodium pyruvate.

DMEM (LG) With low glucose. W/O L-glutamine, L-cystine, L-methionine and phenol red.
DML55-6X500ML	Caisson Labs	6 x 500 ml	EUR 298
Product line: Animal Cell Culture Media Product family: Dulbecco's Modified Eagle Medium
Description: With low glucose. Without L-glutamine, L-cystine, L-methionine and phenol red.

DMEM (HG) With high-glucose, L-glutamine, and 25mM HEPES. W/O sodium pyruvate and phenol red.
DML12-6X500ML	Caisson Labs	6 x 500 ml	EUR 145
Product line: Animal Cell Culture Media Product family: Dulbecco's Modified Eagle Medium
Description: With high-glucose, L-glutamine, and 25mM HEPES. Without sodium pyruvate and phenol red.

Ham's F-12 W/O D-Glucose, L-Glutamine, and Phenol Red.
HFL10-500ML	Caisson Labs	500 ml	EUR 90
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: Without D-Glucose, L-Glutamine, and Phenol Red.

Ham's F-12 (Kaighn's Modification) With L-glutamine. W/O phenol red.
HFL12-500ML	Caisson Labs	500 ml	EUR 81
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.
HFP10-10LT	Caisson Labs	10 L	EUR 75
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.
HFP10-10X1LT	Caisson Labs	10 x 1 L	EUR 83
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.
HFP10-50LT	Caisson Labs	50 L	EUR 107
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red
CM020-050	GenDepot	500ml	EUR 85

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red
CM020-300	GenDepot	6x500ml	EUR 165

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red
CM020-310	GenDepot	10x500ml	EUR 219

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red
CM020-320	GenDepot	20x500ml	EUR 340

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red
CM020-350	GenDepot	50x500ml	EUR 585

Phenol
20-abx184753	Abbexa	EUR 244.00 EUR 217.00	1 kg 500 g
Shipped within 1-2 weeks.

F12/ Rat F12 ELISA Kit
ELI-02419r	Lifescience Market	96 Tests	EUR 886

CORNING® MATRIGEL® MATRIX HIGH CONCENTRATION (HC), PHENOL-RED FREE *LDEV-FREE, 10ML
354262	CORNING	1/pk	EUR 761
Description: Advanced Cells - DL; ECM - DL

F12 siRNA
20-abx901805	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

F12 siRNA
20-abx915867	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

F12 siRNA
20-abx915868	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

F12 Antibody
ABD6558	Lifescience Market	100 ug	EUR 438

F12 Antibody
32389-100ul	SAB	100ul	EUR 252

F12 antibody
70R-17186	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal F12 antibody

F12 Antibody
DF6558	Affbiotech	200ul	EUR 304
Description: F12 Antibody detects endogenous levels of total F12.

F12 Antibody
1-CSB-PA007918GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

F12 Antibody
1-CSB-PA007918LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

F12 Antibody
1-CSB-PA007918LA01PI	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is Unconjugated. Tested in the following application: ELISA

Ham's F-12 With L-glutamine. W/O phenol red, lipoic acid and linoleic acid.
HFL11-500ML	Caisson Labs	500 ml	EUR 104
Product line: Animal Cell Culture Media Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red, lipoic acid and linoleic acid.

CORNING® MATRIGEL® BASEMENT MEMBRANE MATRIX, PHENOL RED-FREE, 10ML
356237	CORNING	1/pk	EUR 516
Description: Advanced Cells - DL; ECM - DL

Nonyl Phenol
AG037	Unibiotest	1 mg	EUR 523

Nonyl Phenol
AT037	Unibiotest	1mg	EUR 1368

Phenol Red
GT9844-100G	Glentham Life Sciences	100 g	EUR 110

Phenol Red
GT9844-250G	Glentham Life Sciences	250 g	EUR 181

Phenol Red
GT9844-25G	Glentham Life Sciences	25 g	EUR 62

Phenol Red
GT9844-5G	Glentham Life Sciences	5 g	EUR 46

Phenol, 99%
GK6990-100G	Glentham Life Sciences	100 g	EUR 44

Phenol, 99%
GK6990-1KG	Glentham Life Sciences	1 kg	EUR 78

Phenol, 99%
GK6990-500G	Glentham Life Sciences	500 g	EUR 56

Water Phenol
abx082109-250ml	Abbexa	250 ml	EUR 189
Shipped within 5-10 working days.

Phenol red
PB0420	Bio Basic	25g	EUR 70.88
Product category: Culture Media/Indicators/Stains

Phenol, crystalline
PB4112	Bio Basic	500g	EUR 175.28
Product category: Biochemicals/Misc. Biochemicals

F12 Conjugated Antibody
C32389	SAB	100ul	EUR 397

F12 cloning plasmid
CSB-CL007918HU-10ug	Cusabio	10ug	EUR 363
Formulation: 10 μg plasmid + 200μl Glycerol Length: 903 Sequence: atgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctcagtcccagaccccgggagccttgccggcgaagcgggagcagccgccttccctgaccaggaacggcccactgagctgcgggcagcggctccgcaagagtctgtcttcgatgacccgcgtcgt Show more
Description: A cloning plasmid for the F12 gene.

F12 Rabbit pAb
A1691-100ul	Abclonal	100 ul	EUR 308

F12 Rabbit pAb
A1691-200ul	Abclonal	200 ul	EUR 459

F12 Rabbit pAb
A1691-20ul	Abclonal	20 ul	EUR 183

F12 Rabbit pAb
A1691-50ul	Abclonal	50 ul	EUR 223

SILAC- DMEM/F12
433	AthenaES	1L	EUR 88

SILAC - DMEM/F12
423	AthenaES	500 ml	EUR 99

F12 Blocking Peptide
DF6558-BP	Affbiotech	1mg	EUR 195

pCMV-SPORT6-F12
PVT13753	Lifescience Market	2 ug	EUR 391

Anti-F12 antibody
STJ23595	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged.

Phenol Red Solution
CA013-010	GenDepot	100ml	EUR 69

4-(Benzyloxy)phenol
GP9986-100G	Glentham Life Sciences	100 g	EUR 118

4-(Benzyloxy)phenol
GP9986-250G	Glentham Life Sciences	250 g	EUR 198

4-(Benzyloxy)phenol
GP9986-25G	Glentham Life Sciences	25 g	EUR 59

Phenol, 4-propoxy-
20-abx184303	Abbexa	EUR 523.00 EUR 286.00	125g 25 g
Shipped within 1-2 weeks.

2-(Aminomethyl)phenol
20-abx185699	Abbexa	EUR 314.00 EUR 1442.00 EUR 592.00	1 g 25 g 5 g
Shipped within 1-2 weeks.

3-(Aminomethyl)phenol
20-abx185751	Abbexa	EUR 425.00 EUR 2277.00 EUR 857.00	1 g 25 g 5 g
Shipped within 1-2 weeks.

Phenol, saturated (pH7.9)
PC6910	Bio Basic	100ml	EUR 76.1
Product category: Biochemicals/Solvents

Phenol, saturated (pH4.5)
PC6920	Bio Basic	100ml	EUR 76.1
Product category: Biochemicals/Solvents

Ham's F-10 Nutrient Mixture
CM024-050	GenDepot	500ml	EUR 86

Ham's F-10 Nutrient Mixture
CM024-300	GenDepot	6x500ml	EUR 184

Ham's F-10 Nutrient Mixture
CM024-310	GenDepot	10x500ml	EUR 270

Ham's F-10 Nutrient Mixture
CM024-320	GenDepot	20x500ml	EUR 383

Ham's F-10 Nutrient Mixture
CM024-350	GenDepot	50x500ml	EUR 620

Ham's F-12 Nutrient Mixture
CM026-050	GenDepot	500ml	EUR 86

Ham's F-12 Nutrient Mixture
CM026-300	GenDepot	6x500ml	EUR 184

Ham's F-12 Nutrient Mixture
CM026-310	GenDepot	10x500ml	EUR 270

Ham's F-12 Nutrient Mixture
CM026-320	GenDepot	20x500ml	EUR 383

Ham's F-12 Nutrient Mixture
CM026-350	GenDepot	50x500ml	EUR 620

Ham's F-12 (Kaighn's Modification)
CMP26-001	GenDepot	10x1L	EUR 99

Ham's F-12 (Kaighn's Modification)
CMP26-010	GenDepot	10L	EUR 84

Ham's F-12 (Kaighn's Modification)
CMP26-050	GenDepot	50L	EUR 142

Ham's F10, with L-Glutamine
CCM1251-500	Bio Basic	500 mL	EUR 64.05
Product category: Culture Media

CD7(B-F12) Antibody
BNC610310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF660R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC610310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF660R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC680310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF568 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC680310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF568 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC430310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF543 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC430310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF543 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC550310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF555 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC550310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF555 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC040310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF405S conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC040310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF405S conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC050310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF405M conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC050310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF405M conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC400310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF640R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC400310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF640R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC470310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF647 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC470310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF647 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNUM0310-50	Biotium	50uL	EUR 395
Description: Primary antibody against CD7(B-F12), 1mg/mL

Mouse F12 shRNA Plasmid
20-abx975127	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat F12 shRNA Plasmid
20-abx989405	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CD7(B-F12) Antibody
BNC700310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF770 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC700310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF770 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC940310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF594 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC940310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF594 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCH0310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCH0310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC800310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF680 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC800310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF680 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC810310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF680R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC810310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF680R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCP0310-250	Biotium	250uL	EUR 383
Description: Primary antibody against CD7(B-F12), PerCP conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCR0310-250	Biotium	250uL	EUR 383
Description: Primary antibody against CD7(B-F12), RPE conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCA0310-250	Biotium	250uL	EUR 383
Description: Primary antibody against CD7(B-F12), APC conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCAP0310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCAP0310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCB0310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), Biotin conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNCB0310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), Biotin conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC880310-100	Biotium	100uL	EUR 199
Description: Primary antibody against CD7(B-F12), CF488A conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNC880310-500	Biotium	500uL	EUR 544
Description: Primary antibody against CD7(B-F12), CF488A conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody
BNUB0310-100	Biotium	100uL	EUR 209
Description: Primary antibody against CD7(B-F12), Concentration: 0.2mg/mL

CD7(B-F12) Antibody
BNUB0310-500	Biotium	500uL	EUR 458
Description: Primary antibody against CD7(B-F12), Concentration: 0.2mg/mL

Human F12 ELISA Kit
EHF0034	Abclonal	96Tests	EUR 521

Human F12 ELISA Kit
ELA-E0694h	Lifescience Market	96 Tests	EUR 824

Goat F12 ELISA Kit
EGTF0034	Abclonal	96Tests	EUR 521

Canine F12 ELISA Kit
ECF0034	Abclonal	96Tests	EUR 521

Chicken F12 ELISA Kit
ECKF0034	Abclonal	96Tests	EUR 521

Bovine F12 ELISA Kit
EBF0034	Abclonal	96Tests	EUR 521

F12 ELISA KIT|Human
EF000373	Lifescience Market	96 Tests	EUR 689

Porcine F12 ELISA Kit
EPF0034	Abclonal	96Tests	EUR 521

Ham’s F12 phenol free, 6x500ml