Ham’s F12 phenol free

Ham’s F12 phenol free

To Order Now: info@anbioq.org

Human Free PSA (f-PSA) ELISA Kit

PRB-5049-FREE 96 assays
EUR 572

Human Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Hu-48T 48T
EUR 479
  • Should the Human Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor XII (F12) in samples from plasma.

Human Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Hu-96T 96T
EUR 621
  • Should the Human Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor XII (F12) in samples from plasma.

Mouse Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Mu-48T 48T
EUR 489
  • Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.

Mouse Coagulation Factor XII (F12) ELISA Kit

DLR-F12-Mu-96T 96T
EUR 635
  • Should the Mouse Coagulation Factor XII (F12) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor XII (F12) in samples from plasma.

Human Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Hu-48Tests 48 Tests
EUR 500

Human Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Hu-96Tests 96 Tests
EUR 692

Mouse Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Mu-48Tests 48 Tests
EUR 511

Mouse Coagulation Factor XII (F12) ELISA Kit

RDR-F12-Mu-96Tests 96 Tests
EUR 709

Human Coagulation Factor XII (F12) ELISA Kit

RD-F12-Hu-48Tests 48 Tests
EUR 478

Human Coagulation Factor XII (F12) ELISA Kit

RD-F12-Hu-96Tests 96 Tests
EUR 662

Mouse Coagulation Factor XII (F12) ELISA Kit

RD-F12-Mu-48Tests 48 Tests
EUR 489

Mouse Coagulation Factor XII (F12) ELISA Kit

RD-F12-Mu-96Tests 96 Tests
EUR 677

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-050 500ml
EUR 88

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-300 6x500ml
EUR 165

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-310 10x500ml
EUR 219

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-320 20x500ml
EUR 340

DMEM/Ham's F-12 (1:1 Mixture), No Phenol Red

CM018-350 50x500ml
EUR 585

Ham's F-12 W/O L-glutamine and phenol red.

HFL07-500ML 500 ml
EUR 79
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine and phenol red.

Ham's F-12 W/O L-glutamine and phenol red.

HFL07-6X500ML 6 x 500 ml
EUR 148
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine and phenol red.

Ham's F-10 With L-glutamine W/O phenol red.

HFL08-500ML 500 ml
EUR 88
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine without phenol red.

Ham's F-10 With L-glutamine W/O phenol red.

HFL08-6X500ML 6 x 500 ml
EUR 196
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine without phenol red.

Human Free PSA (f-PSA) ELISA Kit

PRB-5049-FREE-5 5 x 96 assays
EUR 2283

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-050 500ml
EUR 85

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-300 6x500ml
EUR 165

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-310 10x500ml
EUR 219

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-320 20x500ml
EUR 340

DMEM/Ham's F-12 (1:1 Mixture), No HEPES, No Phenol Red

CM020-350 50x500ml
EUR 585

Ham's F-12 W/O D-Glucose, L-Glutamine, and Phenol Red.

HFL10-500ML 500 ml
EUR 90
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without D-Glucose, L-Glutamine, and Phenol Red.

Ham's F-12 W/O D-Glucose, L-Glutamine, and Phenol Red.

HFL10-6X500ML 6 x 500 ml
EUR 205
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without D-Glucose, L-Glutamine, and Phenol Red.

Ham's F-12 (Kaighn's Modification) With L-glutamine. W/O phenol red.

HFL12-500ML 500 ml
EUR 81
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red.

Ham's F-12 (Kaighn's Modification) With L-glutamine. W/O phenol red.

HFL12-6X500ML 6 x 500 ml
EUR 153
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.

HFP10-10LT 10 L
EUR 75
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.

HFP10-10X1LT 10 x 1 L
EUR 83
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.

Ham's F-12 W/O L-glutamine, phenol red, and sodium bicarbonate.

HFP10-50LT 50 L
EUR 107
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: Without L-glutamine, phenol red, and sodium bicarbonate.


  • EUR 244.00
  • EUR 217.00
  • 1 kg
  • 500 g
  • Shipped within 1-2 weeks.

F12/ Rat F12 ELISA Kit

ELI-02419r 96 Tests
EUR 886


354262 1/pk
EUR 761
Description: Advanced Cells - DL; ECM - DL

F12 antibody

70R-17186 50 ul
EUR 435
Description: Rabbit polyclonal F12 antibody

F12 Antibody

32389-100ul 100ul
EUR 252

F12 Antibody

DF6558 200ul
EUR 304
Description: F12 Antibody detects endogenous levels of total F12.

F12 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

F12 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

F12 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is Unconjugated. Tested in the following application: ELISA

F12 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F12 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F12 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F12 Antibody

ABD6558 100 ug
EUR 438

Ham's F-12 With L-glutamine. W/O phenol red, lipoic acid and linoleic acid.

HFL11-500ML 500 ml
EUR 104
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red, lipoic acid and linoleic acid.

Ham's F-12 With L-glutamine. W/O phenol red, lipoic acid and linoleic acid.

HFL11-6X500ML 6 x 500 ml
EUR 282
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine. Without phenol red, lipoic acid and linoleic acid.


356237 1/pk
EUR 516
Description: Advanced Cells - DL; ECM - DL

Nonyl Phenol

AT037 1mg
EUR 1368

Water Phenol

abx082109-250ml 250 ml
EUR 189
  • Shipped within 5-10 working days.

Nonyl Phenol

AG037 1 mg
EUR 523

Phenol Red

GT9844-100G 100 g
EUR 110

Phenol Red

GT9844-250G 250 g
EUR 181

Phenol Red

GT9844-25G 25 g
EUR 62

Phenol Red

GT9844-5G 5 g
EUR 46

Phenol, 99%

GK6990-100G 100 g
EUR 44

Phenol, 99%

GK6990-1KG 1 kg
EUR 78

Phenol, 99%

GK6990-500G 500 g
EUR 56

Phenol red

PB0420 25g
EUR 70.88
  • Product category: Culture Media/Indicators/Stains

Phenol, crystalline

PB4112 500g
EUR 175.28
  • Product category: Biochemicals/Misc. Biochemicals


423 500 ml
EUR 99


433 1L
EUR 88

F12 Blocking Peptide

DF6558-BP 1mg
EUR 195

F12 Conjugated Antibody

C32389 100ul
EUR 397

F12 cloning plasmid

CSB-CL007918HU-10ug 10ug
EUR 363
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 903
  • Sequence: atgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctcagtcccagaccccgggagccttgccggcgaagcgggagcagccgccttccctgaccaggaacggcccactgagctgcgggcagcggctccgcaagagtctgtcttcgatgacccgcgtcgt
  • Show more
Description: A cloning plasmid for the F12 gene.

F12 Rabbit pAb

A1691-100ul 100 ul
EUR 308

F12 Rabbit pAb

A1691-200ul 200 ul
EUR 459

F12 Rabbit pAb

A1691-20ul 20 ul
EUR 183

F12 Rabbit pAb

A1691-50ul 50 ul
EUR 223


PVT13753 2 ug
EUR 391

Anti-F12 antibody

STJ23595 100 µl
EUR 277
Description: This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged.

Phenol, 4-propoxy-

  • EUR 523.00
  • EUR 286.00
  • 125g
  • 25 g
  • Shipped within 1-2 weeks.


  • EUR 314.00
  • EUR 1442.00
  • EUR 592.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 425.00
  • EUR 2277.00
  • EUR 857.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.

Phenol Red Solution

CA013-010 100ml
EUR 69


GP9986-100G 100 g
EUR 118


GP9986-250G 250 g
EUR 198


GP9986-25G 25 g
EUR 59

Phenol, saturated (pH7.9)

PC6910 100ml
EUR 76.1
  • Product category: Biochemicals/Solvents

Phenol, saturated (pH4.5)

PC6920 100ml
EUR 76.1
  • Product category: Biochemicals/Solvents

Ham's F-10 Nutrient Mixture

CM024-050 500ml
EUR 86

Ham's F-10 Nutrient Mixture

CM024-300 6x500ml
EUR 184

Ham's F-10 Nutrient Mixture

CM024-310 10x500ml
EUR 270

Ham's F-10 Nutrient Mixture

CM024-320 20x500ml
EUR 383

Ham's F-10 Nutrient Mixture

CM024-350 50x500ml
EUR 620

Ham's F-12 Nutrient Mixture

CM026-050 500ml
EUR 86

Ham's F-12 Nutrient Mixture

CM026-300 6x500ml
EUR 184

Ham's F-12 Nutrient Mixture

CM026-310 10x500ml
EUR 270

Ham's F-12 Nutrient Mixture

CM026-320 20x500ml
EUR 383

Ham's F-12 Nutrient Mixture

CM026-350 50x500ml
EUR 620

Ham's F-12 (Kaighn's Modification)

CMP26-001 10x1L
EUR 99

Ham's F-12 (Kaighn's Modification)

CMP26-010 10L
EUR 84

Ham's F-12 (Kaighn's Modification)

CMP26-050 50L
EUR 142

Ham's F10, with L-Glutamine

CCM1251-500 500 mL
EUR 64.05
  • Product category: Culture Media

Cleaved-F12 (R372) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-F12 (R372). Recognizes Cleaved-F12 (R372) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Human F12 ELISA Kit

EHF0034 96Tests
EUR 521

Human F12 ELISA Kit

ELA-E0694h 96 Tests
EUR 824

Goat F12 ELISA Kit

EGTF0034 96Tests
EUR 521

Bovine F12 ELISA Kit

EBF0034 96Tests
EUR 521

Canine F12 ELISA Kit

ECF0034 96Tests
EUR 521

Chicken F12 ELISA Kit

ECKF0034 96Tests
EUR 521


EF000373 96 Tests
EUR 689

Rat F12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse F12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD7(B-F12) Antibody

BNUB0310-100 100uL
EUR 209
Description: Primary antibody against CD7(B-F12), Concentration: 0.2mg/mL

CD7(B-F12) Antibody

BNUB0310-500 500uL
EUR 458
Description: Primary antibody against CD7(B-F12), Concentration: 0.2mg/mL

CD7(B-F12) Antibody

BNUM0310-50 50uL
EUR 395
Description: Primary antibody against CD7(B-F12), 1mg/mL

CD7(B-F12) Antibody

BNC040310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF405S conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC040310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF405S conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC610310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF660R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC610310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF660R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC470310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF647 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC470310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF647 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC550310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF555 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC550310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF555 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC050310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF405M conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC050310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF405M conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC400310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF640R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC400310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF640R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC430310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF543 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC430310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF543 conjugate, Concentration: 0.1mg/mL

F12 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

F12 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is HRP conjugated. Tested in the following application: ELISA

F12 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

F12 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is FITC conjugated. Tested in the following application: ELISA

F12 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

F12 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F12. Recognizes F12 from Pig. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cleaved-F12 (I20) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-F12 (I20). Recognizes Cleaved-F12 (I20) from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

CD7(B-F12) Antibody

BNC800310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF680 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC800310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF680 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC810310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF680R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC810310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF680R conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCP0310-250 250uL
EUR 383
Description: Primary antibody against CD7(B-F12), PerCP conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCR0310-250 250uL
EUR 383
Description: Primary antibody against CD7(B-F12), RPE conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCA0310-250 250uL
EUR 383
Description: Primary antibody against CD7(B-F12), APC conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCAP0310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCAP0310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCH0310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCH0310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC940310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF594 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC940310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF594 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC700310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF770 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC700310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF770 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCB0310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), Biotin conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNCB0310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), Biotin conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC880310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF488A conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC880310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF488A conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC680310-100 100uL
EUR 199
Description: Primary antibody against CD7(B-F12), CF568 conjugate, Concentration: 0.1mg/mL

CD7(B-F12) Antibody

BNC680310-500 500uL
EUR 544
Description: Primary antibody against CD7(B-F12), CF568 conjugate, Concentration: 0.1mg/mL

Human F12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse F12 ELISA Kit

EMF0034 96Tests
EUR 521

Rat F12 ELISA Kit

ERF0034 96Tests
EUR 521

Sheep F12 ELISA Kit

ESF0034 96Tests
EUR 521

Rabbit F12 ELISA Kit

ERTF0034 96Tests
EUR 521

Monkey F12 ELISA Kit

EMKF0034 96Tests
EUR 521

Porcine F12 ELISA Kit

EPF0034 96Tests
EUR 521

F12 Recombinant Protein (Human)

RP011116 100 ug Ask for price

F12 Recombinant Protein (Rat)

RP200174 100 ug Ask for price

F12 Recombinant Protein (Mouse)

RP132611 100 ug Ask for price

Anti-SOCS6 (M2-F12)

YF-MA16765 100 ug
EUR 363
Description: Mouse monoclonal to SOCS6


abx188185-5g 5 g
EUR 2527
  • Shipped within 1-2 weeks.


abx188331-5g 5 g
EUR 314
  • Shipped within 1-2 weeks.

Phenol Sulfotransferase (PST) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phenol Sulfotransferase (PST) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phenol Sulfotransferase (PST) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phenol Sulfotransferase (PST) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phenol Sulfotransferase (PST) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phenol Sulfotransferase (PST) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Folin & Ciocalteu’s phenol reagent

abx082175-50ml 50 ml
EUR 189
  • Shipped within 5-10 working days.

Ceraplex , No Phenol red

C3320-050 500ml Ask for price

Phenol Red (sodium salt)

HY-D0169A 500mg
EUR 108

Phenol Red sodium salt

GT6682-100G 100 g
EUR 142

Phenol Red sodium salt

GT6682-25G 25 g
EUR 70

Phenol Red sodium salt

GT6682-5G 5 g
EUR 44


P16-104-10kg 10 kg
EUR 899


P16-104-2kg 2kg
EUR 234


P16-104-500g 500 g
EUR 100


P16-105-10kg 10 kg
EUR 743


P16-105-2Kg 2 Kg
EUR 200


P16-105-500g 500 g
EUR 90


P16-121-10kg 10 kg
EUR 1254


P16-121-2Kg 2 Kg
EUR 312


P16-121-500g 500 g
EUR 121


P16-122-10kg 10 kg
EUR 1563


P16-122-2kg 2kg
EUR 379


P16-122-500g 500 g
EUR 139


P16-123-10kg 10 kg
EUR 835


P16-123-2Kg 2 Kg
EUR 221


P16-123-500g 500 g
EUR 96

Recombinant Phenol Sulfotransferase (PST)

  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P50225
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Phenol Sulfotransferase expressed in: E.coli

Recombinant Phenol Sulfotransferase (PST)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52840
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.8kDa
  • Isoelectric Point: 8.5
Description: Recombinant Mouse Phenol Sulfotransferase expressed in: E.coli

Recombinant Phenol Sulfotransferase (PST)

  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17988
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.9kDa
  • Isoelectric Point: 6.6
Description: Recombinant Rat Phenol Sulfotransferase expressed in: E.coli

Phenol red, sodium salt

PD0424 25g
EUR 63.92
  • Product category: Culture Media/Indicators/Stains

Ham's F-10 With L-glutamine.

HFL01-500ML 500 ml
EUR 74
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine.

Ham's F-10 With L-glutamine.

HFL01-6X500ML 6 x 500 ml
EUR 116
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-10 Nutrient Mixtures
Description: With L-glutamine.

Ham's F-12 With L-glutamine.

HFL04-500ML 500 ml
EUR 75
  • Product line: Animal Cell Culture Media
  • Product family: Ham's F-12 Nutrient Mixtures
Description: With L-glutamine.

Ham’s F12 phenol free