Human VIP Rapid cempetitive ELISA

Human VIP Rapid cempetitive ELISA

To Order Now: info@anbioq.org

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-b-48T	DL Develop	48T	EUR 547
Should the Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Bovine Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-b-96T	DL Develop	96T	EUR 715
Should the Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Bovine Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-Ch-48T	DL Develop	48T	EUR 508
Should the Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-Ch-96T	DL Develop	96T	EUR 661
Should the Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit
DLR-VIP-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 534

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 742

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit
RDR-VIP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-b-48Tests	Reddot Biotech	48 Tests	EUR 555

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-b-96Tests	Reddot Biotech	96 Tests	EUR 771

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Ch-48Tests	Reddot Biotech	48 Tests	EUR 511

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Ch-96Tests	Reddot Biotech	96 Tests	EUR 709

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit
RD-VIP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Human VIP/ VIP peptides ELISA Kit
E2664Hu	Sunlong	1 Kit	EUR 605

Human VIP(VIP peptides) ELISA Kit
EH0694	FN Test	96T	EUR 476.25
Detection range: 0.313-20 pg/ml Uniprot ID: P01282 Alias: VIP(vasoactive intestinal peptide)/VIP peptides/PHM27
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188pg/ml

Chicken VIP/ VIP peptides ELISA Kit
E0086Ch	Sunlong	1 Kit	EUR 717

Bovine VIP/ VIP peptides ELISA Kit
E0285Bo	Sunlong	1 Kit	EUR 717

Rat VIP peptides, VIP ELISA Kit
ELA-E0380r	Lifescience Market	96 Tests	EUR 886

Rat Vip/ VIP peptides ELISA Kit
E1030Ra	Sunlong	1 Kit	EUR 571

Mouse Vip/ VIP peptides ELISA Kit
E1577Mo	Sunlong	1 Kit	EUR 571

Human VIP ELISA Kit
ELA-E0380h	Lifescience Market	96 Tests	EUR 824

Human VIP ELISA Kit
EHV0044	Abclonal	96Tests	EUR 521

VIP ELISA KIT|Human
EF000443	Lifescience Market	96 Tests	EUR 689

Human VIP ELISA Kit
STJ150150	St John's Laboratory	1 kit	EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of VIP in human serum, plasma and other biological fluids

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

VIP
RA20077	Neuromics	100 ul	EUR 448

VIP, human, porcine, rat; VIP (28 amino acids)
5-02080	CHI Scientific	4 x 1mg	Ask for price

Bovine VIP ELISA Kit
EBV0044	Abclonal	96Tests	EUR 521

Anserini VIP ELISA Kit
EAV0044	Abclonal	96Tests	EUR 521

Chicken VIP ELISA Kit
ECKV0044	Abclonal	96Tests	EUR 521

Canine VIP ELISA Kit
ECV0044	Abclonal	96Tests	EUR 521

Goat VIP ELISA Kit
EGTV0044	Abclonal	96Tests	EUR 521

Sheep VIP ELISA Kit
ESV0044	Abclonal	96Tests	EUR 521

Porcine VIP ELISA Kit
EPV0044	Abclonal	96Tests	EUR 521

Rabbit VIP ELISA Kit
ERTV0044	Abclonal	96Tests	EUR 521

Rat VIP ELISA Kit
ERV0044	Abclonal	96Tests	EUR 521

Monkey VIP ELISA Kit
EMKV0044	Abclonal	96Tests	EUR 521

Mouse VIP ELISA Kit
EMV0044	Abclonal	96Tests	EUR 521

Rat VIP ELISA Kit
STJ150088	St John's Laboratory	1 kit	EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of VIP in Rat serum, plasma and other biological fluids

VIP antibody
20R-2581	Fitzgerald	50 uL	EUR 918
Description: Rabbit polyclonal VIP antibody

VIP antibody
20R-VP001	Fitzgerald	50 uL	EUR 1035
Description: Guinea Pig polyclonal VIP antibody

VIP antibody
20R-VR001	Fitzgerald	250 uL	EUR 531
Description: Rabbit polyclonal VIP antibody

VIP antibody
10-1760	Fitzgerald	200 ul	EUR 705
Description: Mouse monoclonal VIP antibody

VIP, Antagonist
5-02078	CHI Scientific	4 x 1mg	Ask for price

VIP Antibody
42832-100ul	SAB	100ul	EUR 252

VIP Antibody
1-CSB-PA060076	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VIP. Recognizes VIP from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

VIP Antibody
1-CSB-PA949950	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

VIP Antibody
1-CSB-PA903091	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

[Ala11,22,28]VIP
B5107-1	ApexBio	1 mg	EUR 558

[Ala2,8,9,11,19,22,24,25,27,28]-VIP
B5374-1	ApexBio	1 mg	EUR 389

VIP Antibody
DF6627	Affbiotech	200ul	EUR 304
Description: VIP Antibody detects endogenous levels of total VIP.

VIP Antibody
CSB-PA025858KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VIP Antibody
CSB-PA025858KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VIP antibody
70R-6661	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal VIP antibody raised against the middle region of VIP

VIP siRNA
20-abx906030	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VIP siRNA
20-abx939427	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VIP siRNA
20-abx939428	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VIP Antibody
ABD6627	Lifescience Market	100 ug	EUR 438

VIP Antagonist
H-9935.0500	Bachem	0.5mg	EUR 334
Description: Sum Formula: C154H257N49O40S; CAS# [125093-93-8]

VIP Antagonist
H-9935.1000	Bachem	1.0mg	EUR 576
Description: Sum Formula: C154H257N49O40S; CAS# [125093-93-8]

ELISA kit for Human VIP peptides
EK1680	SAB	96 tests	EUR 586
Description: Enzyme-linked immunosorbent assay kit for quantification of Human VIP peptides in samples from serum, plasma, tissue homogenates and other biological fluids.

Human VIP shRNA Plasmid
20-abx955086	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

VIP (human, mouse, rat)
H-3775.0001	Bachem	1.0mg	EUR 176
Description: Sum Formula: C147H238N44O42S; CAS# [40077-57-4] net

VIP (human, mouse, rat)
H-3775.0005	Bachem	5.0mg	EUR 611
Description: Sum Formula: C147H238N44O42S; CAS# [40077-57-4] net

VIP Recombinant Protein (Human)
RP034339	ABM	100 ug	Ask for price

VIP (Human, Porcine) antibody
Y010	Sceti	50 ul	EUR 427
Description: The VIP (Human, Porcine) antibody is available in Europe and for worldwide shipping via Gentaur.

Canine T4 Rapid ELISA Kit
DEIA1763	Creative Diagnostics	32T	EUR 832

Guinea Pig VIP ELISA Kit
EGV0044	Abclonal	96Tests	EUR 521

VIP ELISA Kit (Rat) (OKCD02978)
OKCD02978	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin.. PHI also causes vasodilation;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.58 pg/mL

VIP ELISA Kit (Cattle) (OKCD02980)
OKCD02980	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHI also causes vasodilation. ;Species reactivity: Cattle;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.63 pg/mL

VIP ELISA Kit (Mouse) (OKCD02981)
OKCD02981	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin. PHM also causes vasodilation;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.71 pg/mL

VIP ELISA Kit (Rat) (OKCA01013)
OKCA01013	Aviva Systems Biology	96 Wells	EUR 917
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin. PHI also causes vasodilation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 pg/mL

VIP ELISA Kit (Bovine) (OKEH07378)
OKEH07378	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5pg/mL

VIP ELISA Kit (Dog) (OKEH07379)
OKEH07379	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5pg/mL

VIP ELISA Kit (Pig) (OKEH07380)
OKEH07380	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

VIP ELISA Kit (Chicken) (OKEH03960)
OKEH03960	Aviva Systems Biology	96 Wells	EUR 883
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 39 pg/mL

Human Vasoactive Intestinal Peptide,VIP ELISA Kit
201-12-1357	SunredBio	96 tests	EUR 440
This Vasoactive Intestinal Peptide ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
20-abx153479	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
20-abx253655	Abbexa	EUR 355.00 EUR 668.00	24 tests 96 tests
Shipped within 5-12 working days.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
CEA380Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
CEA380Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
CEA380Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
CEA380Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
4-CEA380Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Vasoactive Intestinal Peptide elisa. Alternative names of the recognized antigen: PHM27 Intestinal peptide PHV-42 Peptide histidine valine 42 Peptide histidine methioninamide 27
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Vasoactive Intestinal Peptide (VIP) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Vasoactive Intestinal Peptide, VIP ELISA Kit
CSB-E08354h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasoactive Intestinal Peptide, VIP in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Vasoactive Intestinal Peptide, VIP ELISA Kit
1-CSB-E08354h	Cusabio	EUR 967.00 EUR 5925.00 EUR 3134.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasoactive Intestinal Peptide, VIP in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
20-abx575833	Abbexa	EUR 355.00 EUR 668.00	24 tests 96 tests
Shipped within 5-12 working days.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit
20-abx512766	Abbexa	EUR 355.00 EUR 668.00	24 tests 96 tests
Shipped within 5-12 working days.

Human Vasoactive Intestinal Peptide,VIP ELISA Kit
CN-04662H1	ChemNorm	96T	EUR 447

Human Vasoactive Intestinal Peptide,VIP ELISA Kit
CN-04662H2	ChemNorm	48T	EUR 296

Human Vasoactive Intestinal Peptide(VIP)ELISA Kit
GA-E1373HM-48T	GenAsia Biotech	48T	EUR 289

Human Vasoactive Intestinal Peptide(VIP)ELISA Kit
GA-E1373HM-96T	GenAsia Biotech	96T	EUR 466

Human Vasoactive Intestinal Peptide(VIP)ELISA Kit
QY-E00734	Qayee Biotechnology	96T	EUR 361

Human Vasoactive Intestinal Peptide ELISA Kit (VIP)
RK02505	Abclonal	96 Tests	EUR 521

VIP ELISA Kit (Human) : 96 Wells (OKEH00406)
OKEH00406	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM and PHV also cause vasodilation. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 pg/mL

Cobalt Rapid Run
6CoRR-100	ABTBeads	100 ml	EUR 431

Cobalt Rapid Run
6CoRR-25	ABTBeads	25 ml	EUR 166

Cobalt Rapid Run
6CoRR-500	ABTBeads	500 ml	EUR 1474

Nickel Rapid Run
6NiRR-100	ABTBeads	100 ml	EUR 431

Nickel Rapid Run
6NiRR-25	ABTBeads	25 ml	EUR 166

Nickel Rapid Run
6NiRR-500	ABTBeads	500 ml	EUR 1474

VIP Rabbit pAb
A12531-100ul	Abclonal	100 ul	EUR 308

VIP Rabbit pAb
A12531-200ul	Abclonal	200 ul	EUR 459

VIP Rabbit pAb
A12531-20ul	Abclonal	20 ul	EUR 183

VIP Rabbit pAb
A12531-50ul	Abclonal	50 ul	EUR 223

VIP Blocking Peptide
33R-9742	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VIP antibody, catalog no. 70R-6661

Rapid Transformation Kit
156	AthenaES	Kit	EUR 158

VIP, guinea pig
5-02079	CHI Scientific	4 x 1mg	Ask for price

VIP (guinea pig)
B5074-.2	ApexBio	200 ug	EUR 366

VIP Blocking Peptide
DF6627-BP	Affbiotech	1mg	EUR 195

VIP Blocking Peptide
20-abx061989	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

VIP Conjugated Antibody
C42832	SAB	100ul	EUR 397

VIP cloning plasmid
CSB-CL025858HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 510 Sequence: atggacaccagaaataaggcccagctccttgtgctcctgactcttctcagtgtgctcttctcacagacttcggcatggcctctttacagggcaccttctgctctcaggttgggtgacagaataccctttgagggagcaaatgaacctgatcaagtttcattaaaagaagacattga Show more
Description: A cloning plasmid for the VIP gene.

VIP Rabbit pAb
A1804-100ul	Abclonal	100 ul	EUR 308

VIP Rabbit pAb
A1804-200ul	Abclonal	200 ul	EUR 459

VIP Rabbit pAb
A1804-20ul	Abclonal	20 ul	EUR 183

VIP Rabbit pAb
A1804-50ul	Abclonal	50 ul	EUR 223

VIP Polyclonal Antibody
ABP56509-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human VIP Applications tips:
Description: A polyclonal antibody for detection of VIP from Human. This VIP antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human VIP

VIP Polyclonal Antibody
ABP56509-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human VIP Applications tips:
Description: A polyclonal antibody for detection of VIP from Human. This VIP antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human VIP

VIP Polyclonal Antibody
ABP56509-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human VIP Applications tips:
Description: A polyclonal antibody for detection of VIP from Human. This VIP antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human VIP

VIP (guinea pig)
H-5682.0500	Bachem	0.5mg	EUR 393
Description: Sum Formula: C147H239N43O42S2; CAS# [96886-24-7] net

VIP Polyclonal Antibody
ES7508-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VIP from Human. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

VIP Polyclonal Antibody
ES7508-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VIP from Human. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

YB Rapid Ligationkit
FYC003-100R	Yeastern Biotech	1 vial	Ask for price

Calci-Clear Rapid
NAT1318	National Diagnostics	EACH	EUR 75

Calci-Clear Rapid
NAT1320	National Diagnostics	EACH	EUR 128

Calci-Clear Rapid
NAT1322	National Diagnostics	EACH	EUR 386

BASU RaPID plasmid
PVT14054	Lifescience Market	2 ug	EUR 599

Anti-VIP Antibody
RP1108	BosterBio	100ug/vial	EUR 334

Anti-VIP antibody
STJ114405	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the glucagon family. It stimulates myocardial contractility, causes vasodilation, increases glycogenolysis, lowers arterial blood pressure and relaxes the smooth muscle of trachea, stomach and gall bladder. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.

Anti-VIP antibody
STJ16101260	St John's Laboratory	50 µl	EUR 990

Anti-VIP antibody
STJ16101282	St John's Laboratory	50 µl	EUR 990

Anti-VIP antibody
STJ16101394	St John's Laboratory	50 µl	EUR 990

Anti-VIP antibody
STJ16101416	St John's Laboratory	50 µl	EUR 990

Anti-VIP antibody
STJ29867	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the glucagon family. It stimulates myocardial contractility, causes vasodilation, increases glycogenolysis, lowers arterial blood pressure and relaxes the smooth muscle of trachea, stomach and gall bladder. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.

Anti-VIP antibody
STJ96248	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to VIP.

Prepro VIP (111-122) (human)
5-01793	CHI Scientific	4 x 5mg	Ask for price

Prepro VIP (156-170) (human)
5-01794	CHI Scientific	4 x 1mg	Ask for price

Prepro VIP (81-122) (human)
5-01795	CHI Scientific	4 x 1mg	Ask for price

Biotinyl-VIP (human, mouse, rat)
H-5706.0500	Bachem	0.5mg	EUR 1046
Description: Sum Formula: C157H252N46O44S2; CAS# [1815618-13-3] net

Prepro VIP (156-170) (human)
H-9190.0001	Bachem	1.0mg	EUR 212
Description: Sum Formula: C71H106N16O31; CAS# [107902-86-3]

Prepro VIP (156-170) (human)
H-9190.0005	Bachem	5.0mg	EUR 756
Description: Sum Formula: C71H106N16O31; CAS# [107902-86-3]

VIP sulfoxide (human, mouse, rat)
H-4202.0001	Bachem	1.0mg	EUR 248
Description: Sum Formula: C147H238N44O43S; CAS# [95050-90-1] net

VIP sulfoxide (human, mouse, rat)
H-4202.0005	Bachem	5.0mg	EUR 973
Description: Sum Formula: C147H238N44O43S; CAS# [95050-90-1] net

VIP ORF Vector (Human) (pORF)
ORF011447	ABM	1.0 ug DNA	EUR 95

ELISA kit for Chicken VIP peptides
EK1681	SAB	96 tests	EUR 721
Description: Enzyme-linked immunosorbent assay kit for quantification of Chicken VIP peptides in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human VIP (Vasoactive Intestinal Peptide)
E-EL-H2155	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's VIP ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Human VIP. During the reaction, Human VIP in the sample or standard competes with a fixed amount of Human VIP on the Show more
Description: A competitive ELISA kit for quantitative measurement of Human VIP (Vasoactive Intestinal Peptide) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human VIP (Vasoactive Intestinal Peptide)
ELK1453	ELK Biotech	1 plate of 96 wells	EUR 432
A monoclonal antibody specific to Vasoactive Intestinal Peptide (VIP) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Vasoactive Intestinal Peptide (VIP) and unlabeled Vasoactive Intestinal Show more
Description: A competitive Inhibition ELISA kit for detection of Vasoactive Intestinal Peptide from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Vasoactive Intestinal Peptide (VIP)
KTE62665-48T	Abbkine	48T	EUR 354
Vasoactive intestinal peptide (VIP) is a peptide hormone containing 28 amino acid residues and is produced in many areas of the human body including the gut, pancreas and suprachiasmatic nuclei of the hypothalamus in the brain.It has a half-life in t Show more
Description: Quantitative sandwich ELISA for measuring Human Vasoactive Intestinal Peptide (VIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasoactive Intestinal Peptide (VIP)
KTE62665-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Vasoactive intestinal peptide (VIP) is a peptide hormone containing 28 amino acid residues and is produced in many areas of the human body including the gut, pancreas and suprachiasmatic nuclei of the hypothalamus in the brain.It has a half-life in t Show more
Description: Quantitative sandwich ELISA for measuring Human Vasoactive Intestinal Peptide (VIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasoactive Intestinal Peptide (VIP)
KTE62665-96T	Abbkine	96T	EUR 572
Vasoactive intestinal peptide (VIP) is a peptide hormone containing 28 amino acid residues and is produced in many areas of the human body including the gut, pancreas and suprachiasmatic nuclei of the hypothalamus in the brain.It has a half-life in t Show more
Description: Quantitative sandwich ELISA for measuring Human Vasoactive Intestinal Peptide (VIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

VIP (1 - 12), human, porcine, rat
5-02082	CHI Scientific	4 x 5mg	Ask for price

VIP-Lys(Biotin), human, porcine, rat
5-02085	CHI Scientific	4 x 1mg	Ask for price

Biotin-VIP (human, bovine, porcine, rat)
5-00823	CHI Scientific	4 x 1mg	Ask for price

Human Vasoactive Intestinal Peptide (VIP) Peptide
20-abx069654	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Vasoactive Intestinal Peptide (VIP) Peptide
20-abx652275	Abbexa	EUR 578.00 EUR 258.00 EUR 1678.00 EUR 676.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

(D-Phe2)-VIP (human, mouse, rat)
H-5640.0001	Bachem	1.0mg	EUR 244
Description: Sum Formula: C153H242N44O41S; CAS# [104051-15-2]

(b-Asp3)-VIP (human, mouse, rat)
H-6554.0500	Bachem	0.5mg	EUR 393
Description: Sum Formula: C147H238N44O42S; CAS# [1926163-85-0] net

(b-Asp3)-VIP (human, mouse, rat)
H-6554.1000	Bachem	1.0mg	EUR 660
Description: Sum Formula: C147H238N44O42S; CAS# [1926163-85-0] net

VIP (3-28) (human, mouse, rat)
H-6556.0001	Bachem	1.0mg	EUR 225
Description: Sum Formula: C138H226N40O39S; CAS# [115444-33-2] net

VIP (3-28) (human, mouse, rat)
H-6556.0005	Bachem	5.0mg	EUR 803
Description: Sum Formula: C138H226N40O39S; CAS# [115444-33-2] net

VIP (4-28) (human, mouse, rat)
H-6558.0001	Bachem	1.0mg	EUR 200
Description: Sum Formula: C134H221N39O36S; CAS# [64326-02-9] net

VIP (4-28) (human, mouse, rat)
H-6558.0005	Bachem	5.0mg	EUR 708
Description: Sum Formula: C134H221N39O36S; CAS# [64326-02-9] net

VIP (6-28) (human, mouse, rat)
H-2066.0500	Bachem	0.5mg	EUR 273
Description: Sum Formula: C126H207N37O34S; CAS# [69698-54-0]

VIP (6-28) (human, mouse, rat)
H-2066.1000	Bachem	1.0mg	EUR 454
Description: Sum Formula: C126H207N37O34S; CAS# [69698-54-0]

VIP sgRNA CRISPR Lentivector set (Human)
K2611801	ABM	3 x 1.0 ug	EUR 339

Nickel NTA Rapid Run
6RR-NTANI-100	ABTBeads	100 ml	EUR 815

Nickel NTA Rapid Run
6RR-NTANI-25	ABTBeads	25 ml	EUR 262

Nickel NTA Rapid Run
6RR-NTANI-500	ABTBeads	500 ml	EUR 3711

Metal Free Rapid Run
6RR-QH-100	ABTBeads	100 ml	EUR 431

Metal Free Rapid Run
6RR-QH-25	ABTBeads	25 ml	EUR 166

Metal Free Rapid Run
6RR-QH-500	ABTBeads	500 ml	EUR 755

Melamine Rapid Test Kit
abx092011-50tests	Abbexa	50 tests	EUR 370
Shipped within 5-12 working days.

VIP (1 12) Peptide
20-abx265242	Abbexa	EUR 495.00 EUR 815.00 EUR 356.00	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

Mouse VIP shRNA Plasmid
20-abx973370	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat VIP shRNA Plasmid
20-abx987404	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rapid Antibody Purification Kit
AKR-160	Cell Biolabs	10 assays	EUR 519
Description: Cell Biolabs? Rapid Antibody Purification kit is designed for rapid, single-step purification of high-quality IgG from ascites, serum and tissue culture media or hybridoma supernatants.

T4 DNA Ligase (Rapid)
N103-01	Vazyme	600,000 U	EUR 563

NDV rapid test kit
RG15-03	Bionote	1 box	EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

IBD rapid test strip
RG15-04	Bionote	10 boxes	EUR 148
Description: Please check the datasheet of IBD rapid test strip before using the test.

Rabies rapid test strip
RG18-01	Bionote	10 boxes	EUR 151.92
Description: Please check the datasheet of Rabies rapid test strip before using the test.

VIP Recombinant Protein (Rat)
RP236402	ABM	100 ug	Ask for price

VIP Recombinant Protein (Mouse)
RP183806	ABM	100 ug	Ask for price

Rapid RCA Assay Kit
VPK-111	Cell Biolabs	30 assays	EUR 537
Description: Traditionally RCA (replication competent adenovirus) is measured in permissive cells by a plaque-forming unit (PFU) assay which takes 10-14 days. Our Rapid RCA Assay Kit uses an immunocytochemistry staining protocol that requires only a two day incubation.

Rapid RCA Assay Kit
VPK-111-5	Cell Biolabs	5 x 30 assays	EUR 2155
Description: Traditionally RCA (replication competent adenovirus) is measured in permissive cells by a plaque-forming unit (PFU) assay which takes 10-14 days. Our Rapid RCA Assay Kit uses an immunocytochemistry staining protocol that requires only a two day incubation.

anti-VIP Receptor 1
YF-PA15283	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to VIP Receptor 1

anti-VIP Receptor 1
YF-PA15284	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to VIP Receptor 1

anti-VIP Receptor 1
YF-PA15285	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to VIP Receptor 1

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit
20-abx156228	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit
20-abx154854	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human VIP Rapid cempetitive ELISA