Human VIP Rapid cempetitive ELISA

Human VIP Rapid cempetitive ELISA

To Order Now: info@anbioq.org

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Hu-48Tests 48 Tests
EUR 500

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Hu-96Tests 96 Tests
EUR 692

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Hu-48Tests 48 Tests
EUR 478

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Hu-96Tests 96 Tests
EUR 662

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-b-48T 48T
EUR 547
  • Should the Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Bovine Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-b-96T 96T
EUR 715
  • Should the Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Bovine Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-Ch-48T 48T
EUR 508
  • Should the Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-Ch-96T 96T
EUR 661
  • Should the Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-Mu-48T 48T
EUR 489
  • Should the Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-Mu-96T 96T
EUR 635
  • Should the Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-Ra-48T 48T
EUR 508
  • Should the Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit

DLR-VIP-Ra-96T 96T
EUR 661
  • Should the Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Vasoactive Intestinal Peptide (VIP) in samples from serum, plasma or other biological fluids.

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-b-48Tests 48 Tests
EUR 580

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-b-96Tests 96 Tests
EUR 807

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Ch-48Tests 48 Tests
EUR 534

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Ch-96Tests 96 Tests
EUR 742

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Mu-48Tests 48 Tests
EUR 511

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Mu-96Tests 96 Tests
EUR 709

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Ra-48Tests 48 Tests
EUR 534

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit

RDR-VIP-Ra-96Tests 96 Tests
EUR 742

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-b-48Tests 48 Tests
EUR 555

Bovine Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-b-96Tests 96 Tests
EUR 771

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Ch-48Tests 48 Tests
EUR 511

Chicken Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Ch-96Tests 96 Tests
EUR 709

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Mu-48Tests 48 Tests
EUR 489

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Mu-96Tests 96 Tests
EUR 677

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Ra-48Tests 48 Tests
EUR 511

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit

RD-VIP-Ra-96Tests 96 Tests
EUR 709

Human VIP/ VIP peptides ELISA Kit

E2664Hu 1 Kit
EUR 605

Human VIP(VIP peptides) ELISA Kit

EH0694 96T
EUR 476.25
  • Detection range: 0.313-20 pg/ml
  • Uniprot ID: P01282
  • Alias: VIP(vasoactive intestinal peptide)/VIP peptides/PHM27
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188pg/ml

Chicken VIP/ VIP peptides ELISA Kit

E0086Ch 1 Kit
EUR 717

Bovine VIP/ VIP peptides ELISA Kit

E0285Bo 1 Kit
EUR 717

Rat VIP peptides, VIP ELISA Kit

ELA-E0380r 96 Tests
EUR 886

Rat Vip/ VIP peptides ELISA Kit

E1030Ra 1 Kit
EUR 571

Mouse Vip/ VIP peptides ELISA Kit

E1577Mo 1 Kit
EUR 571

Human VIP ELISA Kit

ELA-E0380h 96 Tests
EUR 824

Human VIP ELISA Kit

EHV0044 96Tests
EUR 521

VIP ELISA KIT|Human

EF000443 96 Tests
EUR 689

Human VIP ELISA Kit

STJ150150 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of VIP in human serum, plasma and other biological fluids

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

VIP

RA20077 100 ul
EUR 448

VIP, human, porcine, rat; VIP (28 amino acids)

5-02080 4 x 1mg Ask for price

Bovine VIP ELISA Kit

EBV0044 96Tests
EUR 521

Anserini VIP ELISA Kit

EAV0044 96Tests
EUR 521

Chicken VIP ELISA Kit

ECKV0044 96Tests
EUR 521

Canine VIP ELISA Kit

ECV0044 96Tests
EUR 521

Goat VIP ELISA Kit

EGTV0044 96Tests
EUR 521

Sheep VIP ELISA Kit

ESV0044 96Tests
EUR 521

Porcine VIP ELISA Kit

EPV0044 96Tests
EUR 521

Rabbit VIP ELISA Kit

ERTV0044 96Tests
EUR 521

Rat VIP ELISA Kit

ERV0044 96Tests
EUR 521

Monkey VIP ELISA Kit

EMKV0044 96Tests
EUR 521

Mouse VIP ELISA Kit

EMV0044 96Tests
EUR 521

Rat VIP ELISA Kit

STJ150088 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of VIP in Rat serum, plasma and other biological fluids

VIP antibody

20R-2581 50 uL
EUR 918
Description: Rabbit polyclonal VIP antibody

VIP antibody

20R-VP001 50 uL
EUR 1035
Description: Guinea Pig polyclonal VIP antibody

VIP antibody

20R-VR001 250 uL
EUR 531
Description: Rabbit polyclonal VIP antibody

VIP antibody

10-1760 200 ul
EUR 705
Description: Mouse monoclonal VIP antibody

VIP, Antagonist

5-02078 4 x 1mg Ask for price

VIP Antibody

42832-100ul 100ul
EUR 252

VIP Antibody

1-CSB-PA060076
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VIP. Recognizes VIP from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

VIP Antibody

1-CSB-PA949950
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

VIP Antibody

1-CSB-PA903091
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

[Ala11,22,28]VIP

B5107-1 1 mg
EUR 558

[Ala2,8,9,11,19,22,24,25,27,28]-VIP

B5374-1 1 mg
EUR 389

VIP Antibody

DF6627 200ul
EUR 304
Description: VIP Antibody detects endogenous levels of total VIP.

VIP Antibody

CSB-PA025858KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VIP Antibody

CSB-PA025858KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VIP. Recognizes VIP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VIP antibody

70R-6661 50 ug
EUR 467
Description: Rabbit polyclonal VIP antibody raised against the middle region of VIP

VIP siRNA

20-abx906030
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VIP siRNA

20-abx939427
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VIP siRNA

20-abx939428
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VIP Antibody

ABD6627 100 ug
EUR 438

VIP Antagonist

H-9935.0500 0.5mg
EUR 334
Description: Sum Formula: C154H257N49O40S; CAS# [125093-93-8]

VIP Antagonist

H-9935.1000 1.0mg
EUR 576
Description: Sum Formula: C154H257N49O40S; CAS# [125093-93-8]

ELISA kit for Human VIP peptides

EK1680 96 tests
EUR 586
Description: Enzyme-linked immunosorbent assay kit for quantification of Human VIP peptides in samples from serum, plasma, tissue homogenates and other biological fluids.

Human VIP shRNA Plasmid

20-abx955086
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VIP (human, mouse, rat)

H-3775.0001 1.0mg
EUR 176
Description: Sum Formula: C147H238N44O42S; CAS# [40077-57-4] net

VIP (human, mouse, rat)

H-3775.0005 5.0mg
EUR 611
Description: Sum Formula: C147H238N44O42S; CAS# [40077-57-4] net

VIP Recombinant Protein (Human)

RP034339 100 ug Ask for price

VIP (Human, Porcine) antibody

Y010 50 ul
EUR 427
Description: The VIP (Human, Porcine) antibody is available in Europe and for worldwide shipping via Gentaur.

Canine T4 Rapid ELISA Kit

DEIA1763 32T
EUR 832

Guinea Pig VIP ELISA Kit

EGV0044 96Tests
EUR 521

VIP ELISA Kit (Rat) (OKCD02978)

OKCD02978 96 Wells
EUR 818
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin.. PHI also causes vasodilation;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.58 pg/mL

VIP ELISA Kit (Cattle) (OKCD02980)

OKCD02980 96 Wells
EUR 896
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHI also causes vasodilation. ;Species reactivity: Cattle;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.63 pg/mL

VIP ELISA Kit (Mouse) (OKCD02981)

OKCD02981 96 Wells
EUR 779
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin. PHM also causes vasodilation;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.71 pg/mL

VIP ELISA Kit (Rat) (OKCA01013)

OKCA01013 96 Wells
EUR 917
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin. PHI also causes vasodilation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.39 pg/mL

VIP ELISA Kit (Chicken) (OKEH03960)

OKEH03960 96 Wells
EUR 883
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 39 pg/mL

VIP ELISA Kit (Bovine) (OKEH07378)

OKEH07378 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5pg/mL

VIP ELISA Kit (Dog) (OKEH07379)

OKEH07379 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5pg/mL

VIP ELISA Kit (Pig) (OKEH07380)

OKEH07380 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Human Vasoactive Intestinal Peptide,VIP ELISA Kit

201-12-1357 96 tests
EUR 440
  • This Vasoactive Intestinal Peptide ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

20-abx153479
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

20-abx253655
  • EUR 355.00
  • EUR 668.00
  • 24 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

CEA380Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

CEA380Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

CEA380Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

CEA380Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasoactive Intestinal Peptide (VIP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Vasoactive Intestinal Peptide (VIP) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

4-CEA380Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasoactive Intestinal Peptide elisa. Alternative names of the recognized antigen: PHM27
  • Intestinal peptide PHV-42
  • Peptide histidine valine 42
  • Peptide histidine methioninamide 27
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Vasoactive Intestinal Peptide (VIP) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Vasoactive Intestinal Peptide, VIP ELISA Kit

CSB-E08354h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasoactive Intestinal Peptide, VIP in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Vasoactive Intestinal Peptide, VIP ELISA Kit

1-CSB-E08354h
  • EUR 967.00
  • EUR 5925.00
  • EUR 3134.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasoactive Intestinal Peptide, VIP in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

20-abx575833
  • EUR 355.00
  • EUR 668.00
  • 24 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Vasoactive Intestinal Peptide (VIP) ELISA Kit

20-abx512766
  • EUR 355.00
  • EUR 668.00
  • 24 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Vasoactive Intestinal Peptide,VIP ELISA Kit

CN-04662H1 96T
EUR 447

Human Vasoactive Intestinal Peptide,VIP ELISA Kit

CN-04662H2 48T
EUR 296

Human Vasoactive Intestinal Peptide(VIP)ELISA Kit

GA-E1373HM-48T 48T
EUR 289

Human Vasoactive Intestinal Peptide(VIP)ELISA Kit

GA-E1373HM-96T 96T
EUR 466

Human Vasoactive Intestinal Peptide(VIP)ELISA Kit

QY-E00734 96T
EUR 361

Human Vasoactive Intestinal Peptide ELISA Kit (VIP)

RK02505 96 Tests
EUR 521

VIP ELISA Kit (Human) : 96 Wells (OKEH00406)

OKEH00406 96 Wells
EUR 740
Description: Description of target: VIP causes vasodilation, lowers arterial blood pressure, stimulates myocardial contractility, increases glycogenolysis and relaxes the smooth muscle of trachea, stomach and gall bladder. PHM and PHV also cause vasodilation. PHM-27 is a potent agonist of the calcitonin receptor CALCR, with similar efficacy as calcitonin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 pg/mL

Cobalt Rapid Run

6CoRR-100 100 ml
EUR 431

Cobalt Rapid Run

6CoRR-25 25 ml
EUR 166

Cobalt Rapid Run

6CoRR-500 500 ml
EUR 1474

Nickel Rapid Run

6NiRR-100 100 ml
EUR 431

Nickel Rapid Run

6NiRR-25 25 ml
EUR 166

Nickel Rapid Run

6NiRR-500 500 ml
EUR 1474

Rapid Transformation Kit

156 Kit
EUR 158

YB Rapid Ligationkit

FYC003-100R 1 vial Ask for price

Calci-Clear Rapid

NAT1318 EACH
EUR 75

Calci-Clear Rapid

NAT1320 EACH
EUR 128

Calci-Clear Rapid

NAT1322 EACH
EUR 386

BASU RaPID plasmid

PVT14054 2 ug
EUR 599

VIP Rabbit pAb

A12531-100ul 100 ul
EUR 308

VIP Rabbit pAb

A12531-200ul 200 ul
EUR 459

VIP Rabbit pAb

A12531-20ul 20 ul
EUR 183

VIP Rabbit pAb

A12531-50ul 50 ul
EUR 223

VIP Blocking Peptide

33R-9742 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VIP antibody, catalog no. 70R-6661

VIP, guinea pig

5-02079 4 x 1mg Ask for price

VIP (guinea pig)

B5074-.2 200 ug
EUR 366

VIP Blocking Peptide

DF6627-BP 1mg
EUR 195

VIP Blocking Peptide

20-abx061989
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

VIP Conjugated Antibody

C42832 100ul
EUR 397

VIP cloning plasmid

CSB-CL025858HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 510
  • Sequence: atggacaccagaaataaggcccagctccttgtgctcctgactcttctcagtgtgctcttctcacagacttcggcatggcctctttacagggcaccttctgctctcaggttgggtgacagaataccctttgagggagcaaatgaacctgatcaagtttcattaaaagaagacattga
  • Show more
Description: A cloning plasmid for the VIP gene.

VIP Rabbit pAb

A1804-100ul 100 ul
EUR 308

VIP Rabbit pAb

A1804-200ul 200 ul
EUR 459

VIP Rabbit pAb

A1804-20ul 20 ul
EUR 183

VIP Rabbit pAb

A1804-50ul 50 ul
EUR 223

VIP Polyclonal Antibody

ABP56509-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human VIP
  • Applications tips:
Description: A polyclonal antibody for detection of VIP from Human. This VIP antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human VIP

VIP Polyclonal Antibody

ABP56509-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human VIP
  • Applications tips:
Description: A polyclonal antibody for detection of VIP from Human. This VIP antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human VIP

VIP Polyclonal Antibody

ABP56509-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human VIP
  • Applications tips:
Description: A polyclonal antibody for detection of VIP from Human. This VIP antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human VIP

VIP (guinea pig)

H-5682.0500 0.5mg
EUR 393
Description: Sum Formula: C147H239N43O42S2; CAS# [96886-24-7] net

VIP Polyclonal Antibody

ES7508-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VIP from Human. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

VIP Polyclonal Antibody

ES7508-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VIP from Human. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

Anti-VIP Antibody

RP1108 100ug/vial
EUR 334

Anti-VIP antibody

STJ114405 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the glucagon family. It stimulates myocardial contractility, causes vasodilation, increases glycogenolysis, lowers arterial blood pressure and relaxes the smooth muscle of trachea, stomach and gall bladder. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.

Anti-VIP antibody

STJ16101260 50 µl
EUR 990

Anti-VIP antibody

STJ16101282 50 µl
EUR 990

Anti-VIP antibody

STJ16101394 50 µl
EUR 990

Anti-VIP antibody

STJ16101416 50 µl
EUR 990

Anti-VIP antibody

STJ29867 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the glucagon family. It stimulates myocardial contractility, causes vasodilation, increases glycogenolysis, lowers arterial blood pressure and relaxes the smooth muscle of trachea, stomach and gall bladder. The protein also acts as an antimicrobial peptide with antibacterial and antifungal activity. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.

Anti-VIP antibody

STJ96248 200 µl
EUR 197
Description: Rabbit polyclonal to VIP.

Prepro VIP (111-122) (human)

5-01793 4 x 5mg Ask for price

Prepro VIP (156-170) (human)

5-01794 4 x 1mg Ask for price

Prepro VIP (81-122) (human)

5-01795 4 x 1mg Ask for price

Biotinyl-VIP (human, mouse, rat)

H-5706.0500 0.5mg
EUR 1046
Description: Sum Formula: C157H252N46O44S2; CAS# [1815618-13-3] net

Prepro VIP (156-170) (human)

H-9190.0001 1.0mg
EUR 212
Description: Sum Formula: C71H106N16O31; CAS# [107902-86-3]

Prepro VIP (156-170) (human)

H-9190.0005 5.0mg
EUR 756
Description: Sum Formula: C71H106N16O31; CAS# [107902-86-3]

VIP sulfoxide (human, mouse, rat)

H-4202.0001 1.0mg
EUR 248
Description: Sum Formula: C147H238N44O43S; CAS# [95050-90-1] net

VIP sulfoxide (human, mouse, rat)

H-4202.0005 5.0mg
EUR 973
Description: Sum Formula: C147H238N44O43S; CAS# [95050-90-1] net

VIP ORF Vector (Human) (pORF)

ORF011447 1.0 ug DNA
EUR 95

ELISA kit for Chicken VIP peptides

EK1681 96 tests
EUR 721
Description: Enzyme-linked immunosorbent assay kit for quantification of Chicken VIP peptides in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human VIP (Vasoactive Intestinal Peptide)

E-EL-H2155 1 plate of 96 wells
EUR 377
  • Gentaur's VIP ELISA kit utilizes the Competitive-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with Human VIP. During the reaction, Human VIP in the sample or standard competes with a fixed amount of Human VIP on the
  • Show more
Description: A competitive ELISA kit for quantitative measurement of Human VIP (Vasoactive Intestinal Peptide) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human VIP (Vasoactive Intestinal Peptide)

ELK1453 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Vasoactive Intestinal Peptide (VIP) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Vasoactive Intestinal Peptide (VIP) and unlabeled Vasoactive Intestinal
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Vasoactive Intestinal Peptide from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Vasoactive Intestinal Peptide (VIP)

KTE62665-48T 48T
EUR 354
  • Vasoactive intestinal peptide (VIP) is a peptide hormone containing 28 amino acid residues and is produced in many areas of the human body including the gut, pancreas and suprachiasmatic nuclei of the hypothalamus in the brain.It has a half-life in t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasoactive Intestinal Peptide (VIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasoactive Intestinal Peptide (VIP)

KTE62665-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Vasoactive intestinal peptide (VIP) is a peptide hormone containing 28 amino acid residues and is produced in many areas of the human body including the gut, pancreas and suprachiasmatic nuclei of the hypothalamus in the brain.It has a half-life in t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasoactive Intestinal Peptide (VIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasoactive Intestinal Peptide (VIP)

KTE62665-96T 96T
EUR 572
  • Vasoactive intestinal peptide (VIP) is a peptide hormone containing 28 amino acid residues and is produced in many areas of the human body including the gut, pancreas and suprachiasmatic nuclei of the hypothalamus in the brain.It has a half-life in t
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasoactive Intestinal Peptide (VIP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Nickel NTA Rapid Run

6RR-NTANI-100 100 ml
EUR 815

Nickel NTA Rapid Run

6RR-NTANI-25 25 ml
EUR 262

Nickel NTA Rapid Run

6RR-NTANI-500 500 ml
EUR 3711

Metal Free Rapid Run

6RR-QH-100 100 ml
EUR 431

Metal Free Rapid Run

6RR-QH-25 25 ml
EUR 166

Metal Free Rapid Run

6RR-QH-500 500 ml
EUR 755

Melamine Rapid Test Kit

abx092011-50tests 50 tests
EUR 370
  • Shipped within 5-12 working days.

Rapid Antibody Purification Kit

AKR-160 10 assays
EUR 519
Description: Cell Biolabs? Rapid Antibody Purification kit is designed for rapid, single-step purification of high-quality IgG from ascites, serum and tissue culture media or hybridoma supernatants.

T4 DNA Ligase (Rapid)

N103-01 600,000 U
EUR 563

NDV rapid test kit

RG15-03 1 box
EUR 139.05
Description: Please check the datasheet of NDV rapid test kit before using the test.

IBD rapid test strip

RG15-04 10 boxes
EUR 148
Description: Please check the datasheet of IBD rapid test strip before using the test.

Rabies rapid test strip

RG18-01 10 boxes
EUR 151.92
Description: Please check the datasheet of Rabies rapid test strip before using the test.

Rapid RCA Assay Kit

VPK-111 30 assays
EUR 537
Description: Traditionally RCA (replication competent adenovirus) is measured in permissive cells by a plaque-forming unit (PFU) assay which takes 10-14 days. Our Rapid RCA Assay Kit uses an immunocytochemistry staining protocol that requires only a two day incubation.

Rapid RCA Assay Kit

VPK-111-5 5 x 30 assays
EUR 2155
Description: Traditionally RCA (replication competent adenovirus) is measured in permissive cells by a plaque-forming unit (PFU) assay which takes 10-14 days. Our Rapid RCA Assay Kit uses an immunocytochemistry staining protocol that requires only a two day incubation.

VIP (1 - 12), human, porcine, rat

5-02082 4 x 5mg Ask for price

VIP-Lys(Biotin), human, porcine, rat

5-02085 4 x 1mg Ask for price

Biotin-VIP (human, bovine, porcine, rat)

5-00823 4 x 1mg Ask for price

Human Vasoactive Intestinal Peptide (VIP) Peptide

20-abx069654
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Vasoactive Intestinal Peptide (VIP) Peptide

20-abx652275
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

(D-Phe2)-VIP (human, mouse, rat)

H-5640.0001 1.0mg
EUR 244
Description: Sum Formula: C153H242N44O41S; CAS# [104051-15-2]

(b-Asp3)-VIP (human, mouse, rat)

H-6554.0500 0.5mg
EUR 393
Description: Sum Formula: C147H238N44O42S; CAS# [1926163-85-0] net

(b-Asp3)-VIP (human, mouse, rat)

H-6554.1000 1.0mg
EUR 660
Description: Sum Formula: C147H238N44O42S; CAS# [1926163-85-0] net

VIP (3-28) (human, mouse, rat)

H-6556.0001 1.0mg
EUR 225
Description: Sum Formula: C138H226N40O39S; CAS# [115444-33-2] net

VIP (3-28) (human, mouse, rat)

H-6556.0005 5.0mg
EUR 803
Description: Sum Formula: C138H226N40O39S; CAS# [115444-33-2] net

VIP (4-28) (human, mouse, rat)

H-6558.0001 1.0mg
EUR 200
Description: Sum Formula: C134H221N39O36S; CAS# [64326-02-9] net

VIP (4-28) (human, mouse, rat)

H-6558.0005 5.0mg
EUR 708
Description: Sum Formula: C134H221N39O36S; CAS# [64326-02-9] net

VIP (6-28) (human, mouse, rat)

H-2066.0500 0.5mg
EUR 273
Description: Sum Formula: C126H207N37O34S; CAS# [69698-54-0]

VIP (6-28) (human, mouse, rat)

H-2066.1000 1.0mg
EUR 454
Description: Sum Formula: C126H207N37O34S; CAS# [69698-54-0]

VIP sgRNA CRISPR Lentivector set (Human)

K2611801 3 x 1.0 ug
EUR 339

VIP (1 12) Peptide

20-abx265242
  • EUR 495.00
  • EUR 815.00
  • EUR 356.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Mouse VIP shRNA Plasmid

20-abx973370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat VIP shRNA Plasmid

20-abx987404
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VIP Recombinant Protein (Rat)

RP236402 100 ug Ask for price

VIP Recombinant Protein (Mouse)

RP183806 100 ug Ask for price

anti-VIP Receptor 1

YF-PA15283 50 ul
EUR 363
Description: Mouse polyclonal to VIP Receptor 1

anti-VIP Receptor 1

YF-PA15284 50 ug
EUR 363
Description: Mouse polyclonal to VIP Receptor 1

anti-VIP Receptor 1

YF-PA15285 100 ul
EUR 403
Description: Rabbit polyclonal to VIP Receptor 1

Rat Vasoactive Intestinal Peptide (VIP) ELISA Kit

20-abx156228
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Vasoactive Intestinal Peptide (VIP) ELISA Kit

20-abx154854
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human VIP Rapid cempetitive ELISA