Insulin (large) R1: 2×13.5ml

Insulin (large) R1: 2×13.5ml

To Order Now:

Zingibroside R1
HY-N6924 10mg
EUR 640
Notoginsenoside R1
N1607-20 20 mg
EUR 166
Description: Notoginsenoside R1 has been shown to exhibit antooxidant,anti-inflammatory,antiapoptotic,and immune-stimulatory properties.
Ginsenoside R1
TBW01039 20mg Ask for price
Zingibroside R1
TBZ2642 20mg Ask for price
Notoginsenoside R1
TN02805 25mg Ask for price
Stipuleanoside R1
TBZ0899 unit Ask for price
Rathbunioside R1
TBZ2265 unit Ask for price
Antigen-Antibody Pen For Rabbit Primary antibodies
PEN-R1 1
EUR 202
IFNGamma R1/ Rat IFNGamma R1 ELISA Kit
ELA-E0420r 96 Tests
EUR 886
Njmu-R1 antibody
22401-100ul 100ul
EUR 390
TNF R1 antibody
20R-1464 100 ug
EUR 673
Description: Rabbit polyclonal TNF R1 antibody
TNF-R1 Antibody
EUR 354
TNF-R1 Antibody
EUR 146
TNF R1 antibody
70R-12323 100 ug
EUR 403
Description: Rabbit polyclonal TNF R1 antibody
TNF-R1 Antibody
32304-100ul 100ul
EUR 252
TNF-R1 Antibody
EUR 316
TNF-R1 Antibody
EUR 146
TNF-R1 Antibody
DF6447 200ul
EUR 304
Description: TNF-R1 Antibody detects endogenous levels of total TNF-R1.
sigma R1 Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Gingipain R1 Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
sigma R1 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PACAP-R1 Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
sigma R1 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
sigma R1 siRNA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNF- R1 Antibody
ABD6447 100 ug
EUR 438
GT15061 100 ug
EUR 526
LARGE antibody
70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGF beta R1 antibody
20R-1832 100 ug
EUR 673
Description: Rabbit polyclonal TGF beta R1 antibody
TNF-R1 Blocking Peptide
EUR 153
IFN alpha R1 Antibody
48307-100ul 100ul
EUR 333
IFN alpha R1 Antibody
48307-50ul 50ul
EUR 239
TNF R1 Blocking Peptide
33R-10452 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNF R1 antibody, catalog no. 20R-1464
GABAB R1 Polyclonal Antibody
40945-100ul 100ul
EUR 252
GABAB R1 Polyclonal Antibody
40945-50ul 50ul
EUR 187
Polyclonal TNF-R1 Antibody
APR00027G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNF-R1 . This antibody is tested and proven to work in the following applications:
Polyclonal TNF-R1 Antibody
APR00285G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNF-R1 . This antibody is tested and proven to work in the following applications:
TNF-R1 Blocking Peptide
DF6447-BP 1mg
EUR 195
Gingipain R1 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Gingipain R1 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Gingipain R1 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TNF-R1 Conjugated Antibody
C32304 100ul
EUR 397
TNF-R1 Antibody (Biotin)
abx446691-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
TNF-R1 Antibody (FITC)
abx446693-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
TNF-R1 Antibody (HRP)
abx446695-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
GABAB R1 Polyclonal Antibody
ABP54428-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
GABAB R1 Polyclonal Antibody
ABP54428-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
GABAB R1 Polyclonal Antibody
ABP54428-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
GABAB R1 Polyclonal Antibody
ABP51390-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
GABAB R1 Polyclonal Antibody
ABP51390-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
GABAB R1 Polyclonal Antibody
ABP51390-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
TNF-R1 Polyclonal Antibody
ABP56405-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
TNF-R1 Polyclonal Antibody
ABP56405-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
TNF-R1 Polyclonal Antibody
ABP56405-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
TRH-R1 Polyclonal Antibody
ABP56447-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
TRH-R1 Polyclonal Antibody
ABP56447-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
TRH-R1 Polyclonal Antibody
ABP56447-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
TNF-R1 Polyclonal Antibody
ES7404-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TNF-R1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA
TNF-R1 Polyclonal Antibody
ES7404-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TNF-R1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA
TRH-R1 Polyclonal Antibody
ES7446-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRH-R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
TRH-R1 Polyclonal Antibody
ES7446-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRH-R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GABAB R1 Polyclonal Antibody
ES5427-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GABAB R1 Polyclonal Antibody
ES5427-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GABAB R1 Polyclonal Antibody
ES2389-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
GABAB R1 Polyclonal Antibody
ES2389-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
IL-1 R1/CD121a
GT15109 100 ug
EUR 526
Anti-GABAB R1 antibody
STJ93193 200 µl
EUR 197
Description: Rabbit polyclonal to GABAB R1.
Anti-GABAB R1 antibody
STJ93194 200 µl
EUR 197
Description: Rabbit polyclonal to GABAB R1.
Anti-TNF-R1 antibody
STJ96052 200 µl
EUR 197
Description: Rabbit polyclonal to TNF-R1.
Anti-TRH-R1 antibody
STJ96099 200 µl
EUR 197
Description: Rabbit polyclonal to TRH-R1.
LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE
EF012373 96 Tests
EUR 689
LARGE Blocking Peptide
33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992
Large-CRP OmcBProtein
  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.
Large-CRP OmcBProtein
  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.
LARGE cloning plasmid
CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.
LARGE Rabbit pAb
A19515-100ul 100 ul Ask for price
LARGE Rabbit pAb
A19515-200ul 200 ul Ask for price
LARGE Rabbit pAb
A19515-20ul 20 ul Ask for price
LARGE Rabbit pAb
A19515-50ul 50 ul
EUR 308
anti- LARGE antibody
FNab04697 100µg
EUR 548.75
  • Immunogen: like-glycosyltransferase
  • Uniprot ID: O95461
  • Gene ID: 9215
  • Research Area: Metabolism
Description: Antibody raised against LARGE
Anti-LARGE antibody
PAab04697 100 ug
EUR 386
Anti-LARGE antibody
STJ11100708 50 µl
EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.
Spatulas (Large Pack)
SPAT1 50pack
EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.
GABBR1 antibody (Ser923) (R1-Subunit)
70R-14994 100 ul
EUR 392
Description: Rabbit polyclonal GABBR1 antibody (Ser923) (R1-Subunit)
Anti-CD93/C1Q R1 Antibody
A04939 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD93 Antibody (CD93) detection. Tested with WB in Human.
Porphyromonas gingivalis Gingipain R1 (rgpA)
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 58 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in Mammalian cell
Porphyromonas gingivalis Gingipain R1 (rgpA)
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 68 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in E.coli
Porphyromonas gingivalis Gingipain R1 (rgpA)
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 56 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in Yeast
EHT0546 96Tests
EUR 521
EHN0034 96Tests
EUR 521
EHS0303 96Tests
EUR 521
Bovine NMDA-R1 ELISA Kit
EBN0034 96Tests
EUR 521
EBS0303 96Tests
EUR 521
EBT0546 96Tests
EUR 521
Anserine NMDA-R1 ELISA Kit
EAN0034 96Tests
EUR 521
Anserine STRAIL-R1 ELISA Kit
EAS0303 96Tests
EUR 521
Anserine TRAIL R1 ELISA Kit
EAT0546 96Tests
EUR 521
Chicken NMDA-R1 ELISA Kit
ECKN0034 96Tests
EUR 521

Insulin (large) R1: 2×13.5ml