Large hybridization mesh, 23 x 23cm

Large hybridization mesh, 23 x 23cm

To Order Now: info@anbioq.org

Hybridization cocktails II, 50% Formamide

HD0139 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Hybridization cocktails III, 0% Formamide

HD0143 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Hybridization cocktails, IV 50% Formamide

HD0147 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

NATtrol BCID Panel (23 x 0.2mL)

NATBCP-BIO 23 x 0.2mL
EUR 948.56
  • What is the product classification?
  • NATtrol BCID Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Self-Sealing Sterilization Pouches, 23/4 x 9 (7 x 22.9 cm)

LC3042-200 200/bx
EUR 68

HIV Seroconversion Panel Donor# 75018 (23 X 1 mL)

HIV9077 23 X 1 mL
EUR 2040.56
  • What is the product classification?
  • HIV Seroconversion Panel Donor# 75018 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67449 (23 X 1 mL)

HBV11009 23 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Respiratory Verification Panel 2 (23 x 0.6mL) (Ea)

NATRVP2-BIO 23 x 0.6mL
EUR 971.44
  • What is the product classification?
  • NATtrol Respiratory Verification Panel 2 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

LARGE siRNA

20-abx922269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARGE siRNA

20-abx922270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARGE antibody

70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE

IsHyb In Situ Hybridization (ISH) Kit for 20 slides

K2191020 1 kit
EUR 235
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

IsHyb In Situ Hybridization (ISH) Kit for 50 slides

K2191050 1 kit
EUR 398
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Anti-Dimethyl Histone H3 (Lys79) Rabbit Monoclonal Antibody, Clone#RM181

M06819-23 100ug
EUR 468
Description: Anti-Dimethyl Histone H3 (Lys79) Rabbit Monoclonal Antibody, Clone#RM181 tested in WB, ELISA, Multiplex, ChIP, IHC, reactive to All Vertebrates

IL-12, Interleukin-12, human

RC212-23 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Endostatin, human

RC214-23 20ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Betacellulin, human

RC218-23 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Growth Factors

S100B, monkey

RC230-23 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Other

Betacellulin, murine (mouse)

RC238-23 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Growth Factors

CCL12, murine (mouse)

RC335-23 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Cytokines

UBC12, Ubiquitin Conjugating Enzyme 12 (His6-tagged), human

RC612-23 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Ubiquitins

Interleukin-23/IL-23

E21-S31 10ug
EUR 343

Florisil, 60 - 100 mesh

GE3010-100G 100 g
EUR 70

Florisil, 60 - 100 mesh

GE3010-250G 250 g
EUR 114

Human Kinase Library (I, II, III and IV)

HKIN-X 1 set
EUR 1425

Individual Reaction Mix

G065-X 200 reactions
EUR 167

PMA Real-Time PCR Bacterial Viability Kit - Salmonella enterica (invA) PMAxx

31033-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - E. coli O157:H7 (Z3276) PMAxx

31037-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - E. coli (uidA) PMAxx

31050-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Listeria monocytogenes (hly) PMAxx

31051-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

Viability PCR Starter Kit with PMAxxâ„¢

31075-X 1kit
EUR 363
Description: Minimum order quantity: 1 unit of 1kit

Viability PCR Starter Kit with PMAxxâ„¢ and Enhancer

31076-X 1kit
EUR 363
Description: Minimum order quantity: 1 unit of 1kit

Claudin 23 (Claudin 23) Antibody

abx231737-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE

EF012373 96 Tests
EUR 689

Large-CRP OmcBProtein

20-abx600013
  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

20-abx600014
  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

LARGE cloning plasmid

CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.

anti- LARGE antibody

FNab04697 100µg
EUR 548.75
  • Immunogen: like-glycosyltransferase
  • Uniprot ID: O95461
  • Gene ID: 9215
  • Research Area: Metabolism
Description: Antibody raised against LARGE

LARGE Rabbit pAb

A19515-100ul 100 ul Ask for price

LARGE Rabbit pAb

A19515-200ul 200 ul Ask for price

LARGE Rabbit pAb

A19515-20ul 20 ul Ask for price

LARGE Rabbit pAb

A19515-50ul 50 ul
EUR 308

LARGE Blocking Peptide

33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Anti-LARGE antibody

PAab04697 100 ug
EUR 386

Anti-LARGE antibody

STJ11100708 50 µl
EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.

Spatulas (Large Pack)

SPAT1 50pack
EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.

Matrix Metalloproteinase-23 (MMP-23) Antibody

20-abx013148
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Recombinant Mouse Interleukin-23/IL-23

CS31-10ug 10ug
EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Interleukin-23/IL-23

CS31-1mg 1mg
EUR 3602
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Interleukin-23/IL-23

CS31-500ug 500ug
EUR 2536
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Interleukin-23/IL-23

CS31-50ug 50ug
EUR 598
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

JSH-23

B1645-25 25 mg
EUR 431
Description: JSH-23 is an inhibitor of NF-?B transcriptional activity with IC50 value of 7.1?M [1].JSH-23 is developed to inhibit NF-?B transcriptional activity in LPS-stimulated macrophages RAW 264.7.

JSH-23

B1645-5 5 mg
EUR 151
Description: JSH-23 is an inhibitor of NF-?B transcriptional activity with IC50 value of 7.1?M [1].JSH-23 is developed to inhibit NF-?B transcriptional activity in LPS-stimulated macrophages RAW 264.7.

JSH-23

B1645-5.1 10 mM (in 1mL DMSO)
EUR 160
Description: JSH-23 is an inhibitor of NF-?B transcriptional activity with IC50 value of 7.1?M [1].JSH-23 is developed to inhibit NF-?B transcriptional activity in LPS-stimulated macrophages RAW 264.7.

EC 23

B5509-10 10 mg
EUR 181

EC 23

B5509-25 25 mg
EUR 354

EC 23

B5509-5 5 mg
EUR 137

JSH-23

HY-13982 10mg
EUR 268

AZ-23

HY-15590 100mg
EUR 1944

Tyrphostin 23

HY-15644 10mg
EUR 119

23-Hydroxylongispinogenin

HY-N2274 1mg
EUR 313

S-23

abx188871-25g 25 g
EUR 732
  • Shipped within 1-2 weeks.

23-Hydroxylongispinogenin

TBZ2309 10mg Ask for price

23-Hydroxybetulinicacid

TRQ0055 20mg Ask for price

Magnesium, powder, 150 - 350 mesh

GX0342-100G 100 g
EUR 58

Cesium carbonate, 60 - 80 mesh

abx185375-500g 500 g
EUR 356
  • Shipped within 1-2 weeks.

Bromoacetyl resin (200-400 mesh)

D-2555.0001 1.0g
EUR 139

Bromoacetyl resin (200-400 mesh)

D-2555.0005 5.0g
EUR 441

Protein X (X) Antibody

20-abx300955
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody

20-abx300959
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody

20-abx300963
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody

20-abx319940
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

IL-23/ Rat IL- 23 ELISA Kit

ELA-E0384r 96 Tests
EUR 886

FGF-23/ Rat FGF- 23 ELISA Kit

ELA-E0746r 96 Tests
EUR 886

Human IL-23(Interleukin 23) ELISA Kit

EH3270 96T
EUR 524.1
  • Detection range: 39.063-2500 pg/ml
  • Alias: IL-23/IL-23A/IL23P19/P19/SGRF/IL23A/SGRF/IL-23/IL-23A/IL-23-A/IL-23p19/interleukin 23 p19 subunit/interleukin 23, alpha subunit p19/interleukin-23 subunit alpha/Interleukin-23 subunit p19/JKA3 induced upon T-
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 23.438pg/ml

Mouse Interleukin 23(IL-23)ELISA Kit

GA-E0532MS-48T 48T
EUR 336

Mouse Interleukin 23(IL-23)ELISA Kit

GA-E0532MS-96T 96T
EUR 534

Canine Interleukin 23(IL-23)ELISA Kit

GA-E0071CN-48T 48T
EUR 402

Canine Interleukin 23(IL-23)ELISA Kit

GA-E0071CN-96T 96T
EUR 684

Human Interleukin 23(IL-23)ELISA Kit

GA-E0114HM-48T 48T
EUR 289

Human Interleukin 23(IL-23)ELISA Kit

GA-E0114HM-96T 96T
EUR 466

Rat Interleukin 23(IL-23)ELISA Kit

GA-E0134RT-48T 48T
EUR 317

Rat Interleukin 23(IL-23)ELISA Kit

GA-E0134RT-96T 96T
EUR 496

Rat IL-23(Interleukin 23) ELISA Kit

ER1096 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Alias: IL-23//IL-23A/IL23P19/P19/SGRF/IL23A/SGRF/IL-23/IL-23A/IL-23-A/IL-23p19/interleukin 23 p19 subunit/interleukin 23, alpha subunit p19/interleukin-23 subunit alpha/Interleukin-23 subunit p19/JKA3 induced upon T
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

Sheep IL-23(Interleukin 23) ELISA Kit

ESH0014 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
  • Alias: IL-23/IL-23A/IL23P19/P19/SGRF/IL23A/SGRF/IL-23/IL-23A/IL-23-A/IL-23p19/interleukin 23 p19 subunit/interleukin 23, alpha subunit p19/interleukin-23 subunit alpha/Interleukin-23 subunit p19/JKA3 induced upon T-
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Sheep;Sensitivity: 9.375pg/ml

Porcine IL-23(Interleukin 23) ELISA Kit

EP0096 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
  • Alias: IL-23/IL-23A/IL23P19/P19/SGRF/IL23A/SGRF/IL-23/IL-23A/IL-23-A/IL-23p19/interleukin 23 p19 subunit/interleukin 23, alpha subunit p19/interleukin-23 subunit alpha/Interleukin-23 subunit p19/JKA3 induced upon T-
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Pig;Sensitivity: 46.875pg/ml

Mouse IL-23(Interleukin 23) ELISA Kit

EM0114 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Alias: IL-23/IL-23A/IL23P19/P19/SGRF/IL23A/SGRF/IL-23/IL-23A/IL-23-A/IL-23p19/interleukin 23 p19 subunit/interleukin 23, alpha subunit p19/interleukin-23 subunit alpha/Interleukin-23 subunit p19/JKA3 induced upon T-
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Human Interleukin 23 (IL-23) CLIA Kit

abx195888-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Interleukin 23 (IL-23) CLIA Kit

abx195889-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Interleukin 23 (IL-23) CLIA Kit

abx195890-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Matrix Metalloproteinase-23 (MMP-23) Antibody

31367-05111 150 ug
EUR 261

Human Interleukin 23,IL-23 ELISA Kit

201-12-0075 96 tests
EUR 440
  • This Interleukin 23 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 23, IL-23 ELISA Kit

CSB-E08461h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 23, IL-23 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 23, IL-23 ELISA Kit

1-CSB-E08461h
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 23, IL-23 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Interleukin 23, IL-23 ELISA Kit

CSB-E08462r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 23, IL-23 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Interleukin 23, IL-23 ELISA Kit

1-CSB-E08462r
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 23, IL-23 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Interleukin 23, IL-23 ELISA Kit

CSB-E08463m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 23, IL-23 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin 23, IL-23 ELISA Kit

1-CSB-E08463m
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 23, IL-23 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Interleukin 23,IL-23 ELISA Kit

CN-01821R1 96T
EUR 441

Mouse Interleukin 23,IL-23 ELISA Kit

CN-02301M1 96T
EUR 448

Mouse Interleukin 23,IL-23 ELISA Kit

CN-02301M2 48T
EUR 297

Human Interleukin 23,IL-23 ELISA Kit

CN-03351H1 96T
EUR 441

Human Interleukin 23,IL-23 ELISA Kit

CN-03351H2 48T
EUR 291

IL-23 Interleukin-23 Human Recombinant Protein

PROTQ9NPF7 Regular: 10ug
EUR 317
Description: IL-23 Human Recombinant produced in HEK cells is a 55kDa heterodimeric protein composed of 2 disulfide-linked subunits - 19kDa (p19) and 43 kDa (p40). 

Human Interleukin 23(IL-23)ELISA Kit

QY-E04289 96T
EUR 361

Rat Interleukin 23(IL-23)ELISA Kit

QY-E11519 96T
EUR 361

Rabbit Interleukin 23(IL-23)ELISA Kit

QY-E30032 96T
EUR 374

Bovine Interleukin 23,IL-23 ELISA Kit

QY-E60028 96T
EUR 426

Mouse Interleukin 23(IL-23)ELISA Kit

QY-E20853 96T
EUR 361

Large-CRP OmcB Protein

20-abx600002
  • EUR 1970.00
  • EUR 3919.00
  • EUR 2541.00
  • EUR 1414.00
  • 100 ug
  • 1 mg
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Large-CRP OmcB Protein

20-abx600012
  • EUR 2486.00
  • EUR 1455.00
  • EUR 1622.00
  • EUR 1107.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Chicken LARGE ELISA KIT

ELI-08774c 96 Tests
EUR 928

LARGE ELISA KIT|Human

EF010620 96 Tests
EUR 689

Like Glycosyltransferase (LARGE) Antibody

20-abx124463
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

20-abx128114
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rubisco (Large Chain) Antibody

20-abx159680
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody

20-abx159681
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco Large Chain Antibody

20-abx134717
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rubisco Antibody (Large Chain)

abx332842-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432911-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432912-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx234697-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human LARGE shRNA Plasmid

20-abx956100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Caspase-12 Antibody (Large)

24208-100ul 100ul
EUR 390

Mouse LARGE shRNA Plasmid

20-abx971279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Like Glycosyltransferase (LARGE)

4-RPH936Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95461
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Like Glycosyltransferase expressed in: E.coli

LARGE Recombinant Protein (Human)

RP040651 100 ug Ask for price

pSG5 Large T Plasmid

PVT15908 2 ug
EUR 325

LARGE Recombinant Protein (Rat)

RP207821 100 ug Ask for price

LARGE Recombinant Protein (Mouse)

RP146864 100 ug Ask for price

Measuring Spoon (Large Pack)

SPN1 200pack
EUR 479
Description: Individually wrapped 1.2mL spoons. Sterile. Pack of 200.

ELISA kit for Mouse IL-23 (Interleukin 23)

E-EL-M0731 1 plate of 96 wells
EUR 534
  • Gentaur's IL-23 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-23. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse IL-23 (Interleukin 23) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Human IL-23 (Interleukin 23)

E-CL-H0106 1 plate of 96 wells
EUR 584
  • Gentaur's IL-23 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human IL-23 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human IL-23 (Interleukin 23) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Mouse IL-23 (Interleukin 23)

E-CL-M0464 1 plate of 96 wells
EUR 584
  • Gentaur's IL-23 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-23 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse IL-23 (Interleukin 23) in samples from Serum, Plasma, Cell supernatant

Recombinant Mouse Interleukin-23/IL-23 (C-6His)

CI18-10ug 10ug
EUR 232
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Interleukin-23/IL-23 (C-6His)

CI18-1mg 1mg
EUR 3602
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Interleukin-23/IL-23 (C-6His)

CI18-500ug 500ug
EUR 2536
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse Interleukin-23/IL-23 (C-6His)

CI18-50ug 50ug
EUR 598
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Interleukin-23/IL-23 (C-6His)

CJ40-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS pH7.4.

Recombinant Human Interleukin-23/IL-23 (C-6His)

CJ40-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of PBS pH7.4.

Recombinant Human Interleukin-23/IL-23 (C-6His)

CJ40-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS pH7.4.

Recombinant Human Interleukin-23/IL-23 (C-6His)

CJ40-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS pH7.4.

ELISA kit for Rat IL-23 (Interleukin 23)

E-EL-R0569 1 plate of 96 wells
EUR 534
  • Gentaur's IL-23 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IL-23. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat IL-23 (Interleukin 23) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Rat IL-23 (Interleukin 23)

E-CL-R0403 1 plate of 96 wells
EUR 584
  • Gentaur's IL-23 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat IL-23 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat IL-23 (Interleukin 23) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human IL-23 (Interleukin 23)

E-EL-H0107 1 plate of 96 wells
EUR 534
  • Gentaur's IL-23 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-23. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-23 (Interleukin 23) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat Interleukin-23 (IL-23)

KTE101098-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Interleukin-23 (IL-23) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Interleukin-23 (IL-23)

KTE101098-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Interleukin-23 (IL-23) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Interleukin-23 (IL-23)

KTE101098-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Interleukin-23 (IL-23) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Protein X (X) Antibody (HRP)

20-abx300956
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (FITC)

20-abx300957
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (Biotin)

20-abx300958
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (HRP)

20-abx300960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (FITC)

20-abx300961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (Biotin)

20-abx300962
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (HRP)

20-abx300964
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (FITC)

20-abx300965
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (Biotin)

20-abx300966
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (HRP)

20-abx319941
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (FITC)

20-abx319942
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein X (X) Antibody (Biotin)

20-abx319943
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

23-Hydroxybetulinic acid

HY-N0566 5mg
EUR 380

FGF-23, Human

HY-P7013 10ug
EUR 211

Cytokeratin 23 Antibody

20-abx137380
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

KinaseE-23 Antibody

abx018395-100ul 100 ul
EUR 384
  • Shipped within 5-10 working days.

OsMYB-23 Antibody

abx018572-100ul 100 ul
EUR 384
  • Shipped within 5-10 working days.

Keratin 23 Antibody

ABD9000 100 ug
EUR 438

C.I.Solvent Red 23

abx183922-25g 25 g
EUR 217
  • Shipped within 1-2 weeks.

C.I.Vat Red 23

20-abx180052
  • EUR 230.00
  • EUR 1066.00
  • EUR 425.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.

Cytokeratin 23 antibody

70R-2948 50 ug
EUR 467
Description: Rabbit polyclonal Cytokeratin 23 antibody

Claudin 23 antibody

70R-6102 50 ug
EUR 467
Description: Rabbit polyclonal Claudin 23 antibody raised against the C terminal of CLDN23

MMP-23 Antibody

33442-100ul 100ul
EUR 252

Large hybridization mesh, 23 x 23cm