Mouse anti-Human ADAM17

Mouse anti-Human ADAM17

To Order Now: info@anbioq.org

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RD-ADAM17-Hu-48Tests 48 Tests
EUR 415

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RD-ADAM17-Hu-96Tests 96 Tests
EUR 571

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RDR-ADAM17-Hu-48Tests 48 Tests
EUR 433

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RDR-ADAM17-Hu-96Tests 96 Tests
EUR 597

Anti-ADAM17 Antibody

A00604 100ug/vial
EUR 294

anti- ADAM17 antibody

FNab00138 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: ADAM metallopeptidase domain 17
  • Uniprot ID: P78536
  • Gene ID: 6868
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against ADAM17

Anti-ADAM17 Antibody

PA1844 100ug/vial
EUR 294

Anti-ADAM17 antibody

PAab00138 100 ug
EUR 355

Anti-ADAM17 antibody

STJ22509 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.

Anti-ADAM17 (1F6)

YF-MA10902 100 ug
EUR 363
Description: Mouse monoclonal to ADAM17

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

DLR-ADAM17-Ra-48T 48T
EUR 528
  • Should the Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

DLR-ADAM17-Ra-96T 96T
EUR 690
  • Should the Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RD-ADAM17-Ra-48Tests 48 Tests
EUR 534

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RD-ADAM17-Ra-96Tests 96 Tests
EUR 742

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RDR-ADAM17-Ra-48Tests 48 Tests
EUR 558

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

RDR-ADAM17-Ra-96Tests 96 Tests
EUR 776

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

anti- ADAM17-Specific antibody

FNab00139 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ADAM metallopeptidase domain 17
  • Uniprot ID: P78536
  • Gene ID: 6868
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against ADAM17-Specific

Anti-ADAM17-Specific antibody

PAab00139 100 ug
EUR 355

Anti-ADAM17 / TACE antibody

STJ70149 100 µg
EUR 359

Recombinant human ADAM17

P1442 100ug Ask for price
  • Uniprot ID: P78536
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human ADAM17

Recombinant Human ADAM17

P0557 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P78536
Description: Recombinant Human protein for ADAM17

Mouse Adam17 ELISA KIT

ELI-04356m 96 Tests
EUR 865

Mouse ADAM17 shRNA Plasmid

20-abx969032
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAM17 Recombinant Protein (Mouse)

RP114179 100 ug Ask for price

ADAM17 antibody

70R-21435 50 ul
EUR 435
Description: Rabbit polyclonal ADAM17 antibody

ADAM17 antibody

70R-31104 100 ug
EUR 327
Description: Rabbit polyclonal ADAM17 antibody

ADAM17 Antibody

36043-100ul 100ul
EUR 252

ADAM17 Antibody

49419-100ul 100ul
EUR 333

ADAM17 Antibody

49419-50ul 50ul
EUR 239

ADAM17 Antibody

1-CSB-PA001277GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ADAM17 Antibody

1-CSB-PA050200
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000

ADAM17 Antibody

1-CSB-PA261035
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ADAM17 antibody

70R-33352 100 ug
EUR 327
Description: Rabbit polyclonal ADAM17 antibody

ADAM17 siRNA

20-abx900168
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAM17 siRNA

20-abx906707
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAM17 siRNA

20-abx906708
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Goat Anti-ADAM17 / TACE Antibody

AMM04866G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ADAM17 / TACE . This antibody is tested and proven to work in the following applications:

Anti-ADAM17/Tace Rabbit Monoclonal Antibody

M00604 100ug/vial
EUR 397
Description: Rabbit Monoclonal ADAM17/Tace Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human, Mouse, Rat.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Human ADAM17 ELISA Kit

ELA-E1319h 96 Tests
EUR 824

Human ADAM17 ELISA KIT

ELI-04358h 96 Tests
EUR 824

ADAM17 ELISA KIT|Human

EF005263 96 Tests
EUR 689

Human ADAM17 shRNA Plasmid

20-abx954697
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human ADAM17 Protein

VAng-2873Lsx-100g 100 µg
EUR 3115
Description: Recombinant Human ADAM17 was expressed in Insect cell. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein

VAng-2873Lsx-1mg 1 mg
EUR 17523
Description: Recombinant Human ADAM17 was expressed in Insect cell. (Uniprot ID: P78536)

Adam17 ORF Vector (Mouse) (pORF)

ORF038061 1.0 ug DNA
EUR 95

ADAM17 ELISA Kit (Mouse) (OKCD02340)

OKCD02340 96 Wells
EUR 831
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Plays a role in the proteolytic processing of ACE2. Responsible for the proteolytic release of several other cell-surface proteins, including p75 TNF-receptor, interleukin 1 receptor type II, p55 TNF-receptor, transforming growth factor-alpha, L-selectin, growth hormone receptor, MUC1 and the amyloid precursor protein. Acts as an activator of Notch pathway by mediating cleavage of Notch, generating the membrane-associated intermediate fragment called notch extracellular truncation (NEXT).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

ADAM17 ELISA Kit (Mouse) (OKCA02169)

OKCA02169 96 Wells
EUR 833
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Plays a role in the proteolytic processing of ACE2.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

ADAM17 Rabbit pAb

A0821-100ul 100 ul
EUR 308

ADAM17 Rabbit pAb

A0821-200ul 200 ul
EUR 459

ADAM17 Rabbit pAb

A0821-20ul 20 ul
EUR 183

ADAM17 Rabbit pAb

A0821-50ul 50 ul
EUR 223

ADAM17 antibody (Thr735)

70R-33351 100 ug
EUR 327
Description: Rabbit polyclonal ADAM17 antibody (Thr735)

ADAM17 Conjugated Antibody

C49419 100ul
EUR 397

ADAM17 Conjugated Antibody

C36043 100ul
EUR 397

ADAM17-Specific Antibody

abx230139-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ADAM17 cloning plasmid

CSB-CL001277HU-10ug 10ug
EUR 286
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 630
  • Sequence: atgaggcagtctctcctattcctgaccagcgtggttcctttcgtgctggcgccgcgacctccggatgacccgggcttcggcccccaccagagactcgagaagcttgattctttgctctcagactacgatattctctctttatctaatatccagcagcattcggtaagaaaaagaga
  • Show more
Description: A cloning plasmid for the ADAM17 gene.

ADAM17 ORF Vector (Human) (pORF)

ORF000165 1.0 ug DNA
EUR 95

ADAM17 ELISA Kit (Human) (OKAN05578)

OKAN05578 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

ADAM17 ELISA Kit (Human) (OKCD07488)

OKCD07488 96 Wells
EUR 635
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

Adam17 sgRNA CRISPR Lentivector set (Mouse)

K4825901 3 x 1.0 ug
EUR 339

Rabbit Anti-ADAM17 monoclonal antibody, clone KN21-46

DCABH-5885 100 ul
EUR 777

Cleaved-ADAM17 (R215) Antibody

1-CSB-PA050198
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-ADAM17 (R215). Recognizes Cleaved-ADAM17 (R215) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Phospho-ADAM17 (T735) Antibody

1-CSB-PA050199
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ADAM17 (T735). Recognizes Phospho-ADAM17 (T735) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Porcine ADAM17 ELISA KIT

ELI-04357p 96 Tests
EUR 928

Rat Adam17 ELISA KIT

ELI-04359r 96 Tests
EUR 886

Rat ADAM17 shRNA Plasmid

20-abx985890
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAM17 Recombinant Protein (Rat)

RP189128 100 ug Ask for price

ADAM17 sgRNA CRISPR Lentivector set (Human)

K0042201 3 x 1.0 ug
EUR 339

Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4825902 1.0 ug DNA
EUR 154

Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4825903 1.0 ug DNA
EUR 154

Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4825904 1.0 ug DNA
EUR 154

ADAM17 Protein Vector (Mouse) (pPB-C-His)

PV152242 500 ng
EUR 1065

ADAM17 Protein Vector (Mouse) (pPB-N-His)

PV152243 500 ng
EUR 1065

ADAM17 Protein Vector (Mouse) (pPM-C-HA)

PV152244 500 ng
EUR 1065

ADAM17 Protein Vector (Mouse) (pPM-C-His)

PV152245 500 ng
EUR 1065

ADAM17 sgRNA CRISPR Lentivector (Human) (Target 1)

K0042202 1.0 ug DNA
EUR 154

ADAM17 sgRNA CRISPR Lentivector (Human) (Target 2)

K0042203 1.0 ug DNA
EUR 154

ADAM17 sgRNA CRISPR Lentivector (Human) (Target 3)

K0042204 1.0 ug DNA
EUR 154

ADAM17 Protein Vector (Human) (pPB-His-MBP)

PV319734 500 ng
EUR 329

ADAM17 Protein Vector (Human) (pPB-His-GST)

PV319735 500 ng
EUR 329

ADAM17 Protein Vector (Human) (pPB-C-His)

PV000657 500 ng
EUR 329

ADAM17 Protein Vector (Human) (pPB-N-His)

PV000658 500 ng
EUR 329

ADAM17 Protein Vector (Human) (pPM-C-HA)

PV000659 500 ng
EUR 329

ADAM17 Protein Vector (Human) (pPM-C-His)

PV000660 500 ng
EUR 329

Recombinant Human ADAM17 Protein (aa 215-824)

VAng-2869Lsx-100g 100 µg
EUR 7419
Description: Recombinant Human ADAM17 was expressed in cell free expression systems. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-824)

VAng-2869Lsx-50g 50 µg
EUR 4917
Description: Recombinant Human ADAM17 was expressed in cell free expression systems. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-671)

VAng-2870Lsx-1mg 1 mg
EUR 5095
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-671)

VAng-2870Lsx-200g 200 µg
EUR 3268
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-671)

VAng-2870Lsx-500g 500 µg
EUR 3597
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 226-473)

VAng-2872Lsx-1mg 1 mg
EUR 3940
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 226-473)

VAng-2872Lsx-200g 200 µg
EUR 1411
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 226-473)

VAng-2872Lsx-500g 500 µg
EUR 2675
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

ADAM17 ELISA Kit (Human) : 96 Wells (OKEH00945)

OKEH00945 96 Wells
EUR 740
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. [provided by RefSeq, Feb 2016];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

Polyclonal ADAM17 Antibody (C-term)

APG01551G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 Antibody (N-term)

APG01552G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 (N-term). This antibody is tested and proven to work in the following applications:

Adam17 ORF Vector (Rat) (pORF)

ORF063044 1.0 ug DNA
EUR 506

ADAM17 ELISA Kit (Rat) (OKCD02296)

OKCD02296 96 Wells
EUR 857
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Responsible for the proteolytic release of several other cell-surface proteins, including p75 TNF-receptor, interleukin 1 receptor type II, p55 TNF-receptor, transforming growth factor-alpha, L-selectin, growth hormone receptor, MUC1 and the amyloid precursor protein. Acts as an activator of Notch pathway by mediating cleavage of Notch, generating the membrane-associated intermediate fragment called Notch extracellular truncation (NEXT). Plays a role in the proteolytic processing of ACE2. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

ADAM17 ELISA Kit (Pig) (OKEH07915)

OKEH07915 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23pg/mL

Mouse ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit

20-abx258492
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit

abx516367-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit

20-abx150545
  • EUR 5781.00
  • EUR 3088.00
  • EUR 723.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human A Disintegrin And Metalloprotease 17 (ADAM17) Protein

20-abx065059
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit

abx250770-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit

abx253236-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit

abx570602-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse A Disintegrin And Metalloprotease 17 (ADAM17) CLIA Kit

20-abx492864
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse A Disintegrin And Metalloprotease 17(ADAM17)ELISA Kit

GA-E0728MS-48T 48T
EUR 336

Mouse A Disintegrin And Metalloprotease 17(ADAM17)ELISA Kit

GA-E0728MS-96T 96T
EUR 534

Mouse A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Mu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Mu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Mu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Mu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) in tissue homogenates, cell lysates and other biological fluids.

Mouse A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

4-SEB555Mu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloprotease 17 elisa. Alternative names of the recognized antigen: CD156b
  • TACE
  • CSVP
  • Tumor Necrosis Factor, Alpha, Converting Enzyme
  • Disintegrin and metalloproteinase domain-containing protein 17
  • Snake venom-li
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse A Disintegrin And Metalloprotease 17(ADAM17)ELISA kit

QY-E20026 96T
EUR 361

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx037459-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx028423-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx028423-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx028424-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx028424-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal ADAM17 / TACE Antibody (aa807-823)

APG01548G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (aa807-823). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 / TACE Antibody (C-Terminus)

APG01549G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 / TACE Antibody (C-Terminus)

APG01550G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 Antibody - C-terminal region

APG01553G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 - C-terminal region. This antibody is tested and proven to work in the following applications:

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx412493-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx430638-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

abx230138-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody

20-abx000869
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adam17 sgRNA CRISPR Lentivector set (Rat)

K7528901 3 x 1.0 ug
EUR 339

Human A Disintegrin And Metalloprotease 17 (ADAM17) CLIA Kit

20-abx492863
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human)

4-MAB555Hu22
  • EUR 221.00
  • EUR 2114.00
  • EUR 535.00
  • EUR 274.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17)

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human)

4-PAB555Hu01
  • EUR 209.00
  • EUR 1929.00
  • EUR 493.00
  • EUR 257.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17)

ADAM17 Protein Vector (Human) (pPM-N-D-C-HA)

PV319736 500 ng
EUR 552

ADAM17 Protein Vector (Human) (pPM-N-D-C-His)

PV319737 500 ng
EUR 552

Human A Disintegrin And Metalloprotease 17(ADAM17)ELISA Kit

QY-E02779 96T
EUR 361

Human A Disintegrin And Metalloprotease 17 ELISA Kit (ADAM17)

RK00814 96 Tests
EUR 521

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Hu-10x96wellstestplate 10x96-wells test plate
EUR 3586.13
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Hu-1x48wellstestplate 1x48-wells test plate
EUR 382.98
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Hu-1x96wellstestplate 1x96-wells test plate
EUR 504.25
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

SEB555Hu-5x96wellstestplate 5x96-wells test plate
EUR 1969.13
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human A Disintegrin And Metalloprotease 17 (ADAM17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit

4-SEB555Hu
  • EUR 3637.00
  • EUR 1920.00
  • EUR 505.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as A Disintegrin And Metalloprotease 17 elisa. Alternative names of the recognized antigen: CD156b
  • TACE
  • CSVP
  • Tumor Necrosis Factor, Alpha, Converting Enzyme
  • Disintegrin and metalloproteinase domain-containing protein 17
  • Snake venom-li
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human ADAM17 Protein (Pro 18-Asp 563) [His] (Q9Z0F8)

VAng-0708Lsx-500g 500 µg
EUR 4724
Description: Human ADAM17, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q9Z0F8)

Human ADAM17 Protein (Pro 18-Asp 563) [His] (Q9Z0F8)

VAng-0708Lsx-50g 50 µg
EUR 1288
Description: Human ADAM17, His tag, is expressed in HEK 293 cells. (Uniprot ID: Q9Z0F8)

Human ADAM17 Protein (Pro 18-Asp 563) [His] (NP_064702)

VAng-0709Lsx-500g 500 µg
EUR 4174
Description: Human ADAM17, His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_064702)

Human ADAM17 Protein (Pro 18-Asp 563) [His] (NP_064702)

VAng-0709Lsx-50g 50 µg
EUR 1178
Description: Human ADAM17, His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_064702)

ELISA kit for Mouse ADAM17 (A Disintegrin And Metalloprotease 17)

ELK5476 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to A Disintegrin And Metalloprotease 17 (ADAM17). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
  • Show more
Description: A sandwich ELISA kit for detection of A Disintegrin And Metalloprotease 17 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Adam17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4825905 3 x 1.0 ug
EUR 376

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx213698
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx103981
  • EUR 342.00
  • EUR 133.00
  • EUR 940.00
  • EUR 481.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx110819
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx130120
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx131773
  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx171029
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx270145
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx326388
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody

20-abx323786
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adam17 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7528902 1.0 ug DNA
EUR 154

Adam17 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7528903 1.0 ug DNA
EUR 154

Adam17 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7528904 1.0 ug DNA
EUR 154

ADAM17 Protein Vector (Rat) (pPB-C-His)

PV252174 500 ng
EUR 1191

ADAM17 Protein Vector (Rat) (pPB-N-His)

PV252175 500 ng
EUR 1191

ADAM17 Protein Vector (Rat) (pPM-C-HA)

PV252176 500 ng
EUR 1191

ADAM17 Protein Vector (Rat) (pPM-C-His)

PV252177 500 ng
EUR 1191

Recombinant A Disintegrin And Metalloprotease 17 (ADAM17)

4-RPB555Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78536
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human A Disintegrin And Metalloprotease 17 expressed in: E.coli

Recombinant A Disintegrin And Metalloprotease 17 (ADAM17)

4-RPB555Ra01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z1K9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat A Disintegrin And Metalloprotease 17 expressed in: E.coli

Adam17 3'UTR Luciferase Stable Cell Line

TU101356 1.0 ml Ask for price

Adam17 3'UTR GFP Stable Cell Line

TU151356 1.0 ml Ask for price

Adam17 3'UTR Luciferase Stable Cell Line

TU200249 1.0 ml Ask for price

Adam17 3'UTR GFP Stable Cell Line

TU250249 1.0 ml Ask for price

ADAM17 3'UTR GFP Stable Cell Line

TU050301 1.0 ml
EUR 1521

Mouse anti-Human ADAM17