anti-ADAM17 antibody

anti-ADAM17 antibody

To Order Now:

Anti-ADAM17 Antibody
A00604 100ug/vial
EUR 294
Anti-ADAM17 antibody
PAab00138 100 ug
EUR 355
Anti-ADAM17 Antibody
PA1844 100ug/vial
EUR 294
Anti-ADAM17 antibody
STJ22509 100 µl
EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
anti- ADAM17-Specific antibody
FNab00139 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ADAM metallopeptidase domain 17
  • Uniprot ID: P78536
  • Gene ID: 6868
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against ADAM17-Specific
Anti-ADAM17-Specific antibody
PAab00139 100 ug
EUR 355
Anti-ADAM17 / TACE antibody
STJ70149 100 µg
EUR 359
Anti-ADAM17 (1F6)
YF-MA10902 100 ug
EUR 363
Description: Mouse monoclonal to ADAM17
Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Hu-48T 48T
EUR 423
  • Should the Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.
Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Hu-96T 96T
EUR 544
  • Should the Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Ra-48T 48T
EUR 528
  • Should the Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Ra-96T 96T
EUR 690
  • Should the Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.
Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Hu-48Tests 48 Tests
EUR 415
Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Hu-96Tests 96 Tests
EUR 571
Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Ra-48Tests 48 Tests
EUR 534
Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Ra-96Tests 96 Tests
EUR 742
Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Hu-48Tests 48 Tests
EUR 433
Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Hu-96Tests 96 Tests
EUR 597
Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Ra-48Tests 48 Tests
EUR 558
Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Ra-96Tests 96 Tests
EUR 776
ADAM17 antibody
70R-33352 100 ug
EUR 327
Description: Rabbit polyclonal ADAM17 antibody
ADAM17 antibody
70R-21435 50 ul
EUR 435
Description: Rabbit polyclonal ADAM17 antibody
ADAM17 antibody
70R-31104 100 ug
EUR 327
Description: Rabbit polyclonal ADAM17 antibody
ADAM17 Antibody
36043-100ul 100ul
EUR 252
ADAM17 Antibody
49419-100ul 100ul
EUR 333
ADAM17 Antibody
49419-50ul 50ul
EUR 239
ADAM17 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ADAM17 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50
ADAM17 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000
Polyclonal Goat Anti-ADAM17 / TACE Antibody
AMM04866G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ADAM17 / TACE . This antibody is tested and proven to work in the following applications:
Anti-ADAM17/Tace Rabbit Monoclonal Antibody
M00604 100ug/vial
EUR 397
Description: Rabbit Monoclonal ADAM17/Tace Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human, Mouse, Rat.
ADAM17 Conjugated Antibody
C49419 100ul
EUR 397
ADAM17 Conjugated Antibody
C36043 100ul
EUR 397
ADAM17-Specific Antibody
abx230139-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
ADAM17 antibody (Thr735)
70R-33351 100 ug
EUR 327
Description: Rabbit polyclonal ADAM17 antibody (Thr735)
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Cleaved-ADAM17 (R215) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-ADAM17 (R215). Recognizes Cleaved-ADAM17 (R215) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Phospho-ADAM17 (T735) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ADAM17 (T735). Recognizes Phospho-ADAM17 (T735) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
Rabbit Anti-ADAM17 monoclonal antibody, clone KN21-46
DCABH-5885 100 ul
EUR 777
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
ADAM17 Rabbit pAb
A0821-100ul 100 ul
EUR 308
ADAM17 Rabbit pAb
A0821-200ul 200 ul
EUR 459
ADAM17 Rabbit pAb
A0821-20ul 20 ul
EUR 183
ADAM17 Rabbit pAb
A0821-50ul 50 ul
EUR 223
ADAM17 cloning plasmid
CSB-CL001277HU-10ug 10ug
EUR 286
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 630
  • Sequence: atgaggcagtctctcctattcctgaccagcgtggttcctttcgtgctggcgccgcgacctccggatgacccgggcttcggcccccaccagagactcgagaagcttgattctttgctctcagactacgatattctctctttatctaatatccagcagcattcggtaagaaaaagaga
  • Show more
Description: A cloning plasmid for the ADAM17 gene.
Recombinant human ADAM17
P1442 100ug Ask for price
  • Uniprot ID: P78536
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human ADAM17
Recombinant Human ADAM17
P0557 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P78536
Description: Recombinant Human protein for ADAM17
Polyclonal ADAM17 Antibody (C-term)
APG01551G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal ADAM17 Antibody (N-term)
APG01552G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal ADAM17 / TACE Antibody (aa807-823)
APG01548G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (aa807-823). This antibody is tested and proven to work in the following applications:
Polyclonal ADAM17 / TACE Antibody (C-Terminus)
APG01549G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal ADAM17 / TACE Antibody (C-Terminus)
APG01550G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal ADAM17 Antibody - C-terminal region
APG01553G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 - C-terminal region. This antibody is tested and proven to work in the following applications:
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx037459-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028423-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028423-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028424-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028424-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx412493-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx430638-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx230138-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Rat ADAM17 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ADAM17 ELISA Kit
ELA-E1319h 96 Tests
EUR 824
Mouse Adam17 ELISA KIT
ELI-04356m 96 Tests
EUR 865
ELI-04357p 96 Tests
EUR 928
ELI-04358h 96 Tests
EUR 824
Rat Adam17 ELISA KIT
ELI-04359r 96 Tests
EUR 886
EF005263 96 Tests
EUR 689
Human ADAM17 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ADAM17 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ADAM17 Recombinant Protein (Rat)
RP189128 100 ug Ask for price
ADAM17 Recombinant Protein (Mouse)
RP114179 100 ug Ask for price
Recombinant Human ADAM17 Protein
VAng-2873Lsx-100g 100 µg
EUR 3115
Description: Recombinant Human ADAM17 was expressed in Insect cell. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein
VAng-2873Lsx-1mg 1 mg
EUR 17523
Description: Recombinant Human ADAM17 was expressed in Insect cell. (Uniprot ID: P78536)
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 342.00
  • EUR 133.00
  • EUR 940.00
  • EUR 481.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADAM17 ORF Vector (Human) (pORF)
ORF000165 1.0 ug DNA
EUR 95
Adam17 ORF Vector (Mouse) (pORF)
ORF038061 1.0 ug DNA
EUR 95
Adam17 ORF Vector (Rat) (pORF)
ORF063044 1.0 ug DNA
EUR 506
ADAM17 ELISA Kit (Rat) (OKCD02296)
OKCD02296 96 Wells
EUR 857
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Responsible for the proteolytic release of several other cell-surface proteins, including p75 TNF-receptor, interleukin 1 receptor type II, p55 TNF-receptor, transforming growth factor-alpha, L-selectin, growth hormone receptor, MUC1 and the amyloid precursor protein. Acts as an activator of Notch pathway by mediating cleavage of Notch, generating the membrane-associated intermediate fragment called Notch extracellular truncation (NEXT). Plays a role in the proteolytic processing of ACE2. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL
ADAM17 ELISA Kit (Human) (OKAN05578)
OKAN05578 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL
ADAM17 ELISA Kit (Mouse) (OKCD02340)
OKCD02340 96 Wells
EUR 831
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Plays a role in the proteolytic processing of ACE2. Responsible for the proteolytic release of several other cell-surface proteins, including p75 TNF-receptor, interleukin 1 receptor type II, p55 TNF-receptor, transforming growth factor-alpha, L-selectin, growth hormone receptor, MUC1 and the amyloid precursor protein. Acts as an activator of Notch pathway by mediating cleavage of Notch, generating the membrane-associated intermediate fragment called notch extracellular truncation (NEXT).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL
ADAM17 ELISA Kit (Mouse) (OKCA02169)
OKCA02169 96 Wells
EUR 833
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Plays a role in the proteolytic processing of ACE2.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL
ADAM17 ELISA Kit (Human) (OKCD07488)
OKCD07488 96 Wells
EUR 635
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL
ADAM17 ELISA Kit (Pig) (OKEH07915)
OKEH07915 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23pg/mL
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (FITC)
  • EUR 398.00
  • EUR 230.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (FITC)
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (APC)
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (PE)
  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (Biotin)
  • EUR 356.00
  • EUR 230.00
  • EUR 1024.00
  • EUR 509.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ADAM17 sgRNA CRISPR Lentivector set (Human)
K0042201 3 x 1.0 ug
EUR 339
Adam17 sgRNA CRISPR Lentivector set (Mouse)
K4825901 3 x 1.0 ug
EUR 339
Adam17 sgRNA CRISPR Lentivector set (Rat)
K7528901 3 x 1.0 ug
EUR 339
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human)
  • EUR 209.00
  • EUR 1929.00
  • EUR 493.00
  • EUR 257.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17)
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat)
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Leu221~Ser451)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17)
A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human)
  • EUR 221.00
  • EUR 2114.00
  • EUR 535.00
  • EUR 274.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17)
ADAM17 sgRNA CRISPR Lentivector (Human) (Target 1)
K0042202 1.0 ug DNA
EUR 154
ADAM17 sgRNA CRISPR Lentivector (Human) (Target 2)
K0042203 1.0 ug DNA
EUR 154
ADAM17 sgRNA CRISPR Lentivector (Human) (Target 3)
K0042204 1.0 ug DNA
EUR 154
Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4825902 1.0 ug DNA
EUR 154
Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4825903 1.0 ug DNA
EUR 154
Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4825904 1.0 ug DNA
EUR 154
Adam17 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7528902 1.0 ug DNA
EUR 154
Adam17 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7528903 1.0 ug DNA
EUR 154
Adam17 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7528904 1.0 ug DNA
EUR 154
ADAM17 Protein Vector (Human) (pPB-C-His)
PV000657 500 ng
EUR 329
ADAM17 Protein Vector (Human) (pPB-N-His)
PV000658 500 ng
EUR 329
ADAM17 Protein Vector (Human) (pPM-C-HA)
PV000659 500 ng
EUR 329
ADAM17 Protein Vector (Human) (pPM-C-His)
PV000660 500 ng
EUR 329
Recombinant A Disintegrin And Metalloprotease 17 (ADAM17)
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78536
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human A Disintegrin And Metalloprotease 17 expressed in: E.coli
Recombinant A Disintegrin And Metalloprotease 17 (ADAM17)
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z1K9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat A Disintegrin And Metalloprotease 17 expressed in: E.coli
ADAM17 Protein Vector (Human) (pPB-His-MBP)
PV319734 500 ng
EUR 329
ADAM17 Protein Vector (Human) (pPB-His-GST)
PV319735 500 ng
EUR 329
ADAM17 Protein Vector (Mouse) (pPB-C-His)
PV152242 500 ng
EUR 1065
ADAM17 Protein Vector (Mouse) (pPB-N-His)
PV152243 500 ng
EUR 1065
ADAM17 Protein Vector (Mouse) (pPM-C-HA)
PV152244 500 ng
EUR 1065
ADAM17 Protein Vector (Mouse) (pPM-C-His)
PV152245 500 ng
EUR 1065
ADAM17 Protein Vector (Rat) (pPB-C-His)
PV252174 500 ng
EUR 1191
ADAM17 Protein Vector (Rat) (pPB-N-His)
PV252175 500 ng
EUR 1191
ADAM17 Protein Vector (Rat) (pPM-C-HA)
PV252176 500 ng
EUR 1191
ADAM17 Protein Vector (Rat) (pPM-C-His)
PV252177 500 ng
EUR 1191
Adam17 3'UTR Luciferase Stable Cell Line
TU200249 1.0 ml Ask for price
Adam17 3'UTR GFP Stable Cell Line
TU151356 1.0 ml Ask for price
ADAM17 3'UTR Luciferase Stable Cell Line
TU000301 1.0 ml
EUR 1521
Adam17 3'UTR Luciferase Stable Cell Line
TU101356 1.0 ml Ask for price
ADAM17 3'UTR GFP Stable Cell Line
TU050301 1.0 ml
EUR 1521
Adam17 3'UTR GFP Stable Cell Line
TU250249 1.0 ml Ask for price
Recombinant Pig ADAM17 Protein (aa 1-112)
VAng-2868Lsx-1mg 1 mg
EUR 3103
Description: Recombinant Pig ADAM17 was expressed in E. coli. (Uniprot ID: O77636)
Recombinant Pig ADAM17 Protein (aa 1-112)
VAng-2868Lsx-200g 200 µg
EUR 1906
Description: Recombinant Pig ADAM17 was expressed in E. coli. (Uniprot ID: O77636)
Recombinant Pig ADAM17 Protein (aa 1-112)
VAng-2868Lsx-500g 500 µg
EUR 2099
Description: Recombinant Pig ADAM17 was expressed in E. coli. (Uniprot ID: O77636)
Recombinant Human ADAM17 Protein (aa 215-824)
VAng-2869Lsx-100g 100 µg
EUR 7419
Description: Recombinant Human ADAM17 was expressed in cell free expression systems. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein (aa 215-824)
VAng-2869Lsx-50g 50 µg
EUR 4917
Description: Recombinant Human ADAM17 was expressed in cell free expression systems. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein (aa 215-671)
VAng-2870Lsx-1mg 1 mg
EUR 5095
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein (aa 215-671)
VAng-2870Lsx-200g 200 µg
EUR 3268
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein (aa 215-671)
VAng-2870Lsx-500g 500 µg
EUR 3597
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein (aa 226-473)
VAng-2872Lsx-1mg 1 mg
EUR 3940
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein (aa 226-473)
VAng-2872Lsx-200g 200 µg
EUR 1411
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)
Recombinant Human ADAM17 Protein (aa 226-473)
VAng-2872Lsx-500g 500 µg
EUR 2675
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)
ADAM17 ELISA Kit (Human) : 96 Wells (OKEH00945)
OKEH00945 96 Wells
EUR 740
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. [provided by RefSeq, Feb 2016];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL
A Disintegrin And Metalloprotease 17 Phospho-Thr735 (ADAM17 pT735) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), APC
  • EUR 289.00
  • EUR 2483.00
  • EUR 714.00
  • EUR 360.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with APC.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), Biotinylated
  • EUR 270.00
  • EUR 1879.00
  • EUR 582.00
  • EUR 322.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Biotin.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), Cy3
  • EUR 344.00
  • EUR 3269.00
  • EUR 911.00
  • EUR 439.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Cy3.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), FITC
  • EUR 251.00
  • EUR 2006.00
  • EUR 591.00
  • EUR 308.00
  • EUR 176.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with FITC.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), HRP
  • EUR 267.00
  • EUR 2168.00
  • EUR 635.00
  • EUR 329.00
  • EUR 186.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with HRP.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), PE
  • EUR 251.00
  • EUR 2006.00
  • EUR 591.00
  • EUR 308.00
  • EUR 176.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Lys226~Arg473)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with PE.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Leu221~Ser451)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with APC.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), Biotinylated
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Leu221~Ser451)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Biotin.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Leu221~Ser451)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Cy3.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Leu221~Ser451)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with FITC.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Leu221~Ser451)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with HRP.
A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ADAM17 (Leu221~Ser451)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with PE.
A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), APC
  • EUR 307.00
  • EUR 2735.00
  • EUR 777.00
  • EUR 386.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with APC.
A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), Biotinylated
  • EUR 283.00
  • EUR 2064.00
  • EUR 628.00
  • EUR 341.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Biotin.
A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), Cy3
  • EUR 368.00
  • EUR 3605.00
  • EUR 995.00
  • EUR 473.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Cy3.
A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), FITC
  • EUR 266.00
  • EUR 2208.00
  • EUR 642.00
  • EUR 328.00
  • EUR 182.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with FITC.
A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), HRP
  • EUR 283.00
  • EUR 2387.00
  • EUR 690.00
  • EUR 351.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with HRP.
A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), PE
  • EUR 266.00
  • EUR 2208.00
  • EUR 642.00
  • EUR 328.00
  • EUR 182.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys226~Arg473
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with PE.
Mouse ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx516367-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Pig ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx516368-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx361925-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx363208-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx570602-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

anti-ADAM17 antibody