anti-ADAM17 antibody

anti-ADAM17 antibody

To Order Now: info@anbioq.org

Anti-ADAM17 Antibody
A00604	BosterBio	100ug/vial	EUR 294

Anti-ADAM17 antibody
PAab00138	Lifescience Market	100 ug	EUR 355

Anti-ADAM17 Antibody
PA1844	BosterBio	100ug/vial	EUR 294

Anti-ADAM17 antibody
STJ22509	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

anti- ADAM17-Specific antibody
FNab00139	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 IHC: 1:20-1:200 Immunogen: ADAM metallopeptidase domain 17 Uniprot ID: P78536 Gene ID: 6868 Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against ADAM17-Specific

Anti-ADAM17-Specific antibody
PAab00139	Lifescience Market	100 ug	EUR 355

Anti-ADAM17 / TACE antibody
STJ70149	St John's Laboratory	100 µg	EUR 359

Anti-ADAM17 (1F6)
YF-MA10902	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ADAM17

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Hu-48T	DL Develop	48T	EUR 423
Should the Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Hu-96T	DL Develop	96T	EUR 544
Should the Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Ra-48T	DL Develop	48T	EUR 528
Should the Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
DLR-ADAM17-Ra-96T	DL Develop	96T	EUR 690
Should the Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat A Disintegrin And Metalloprotease 17 (ADAM17) in samples from tissue homogenates, cell lysates or other biological fluids.

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Hu-48Tests	Reddot Biotech	48 Tests	EUR 415

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Hu-96Tests	Reddot Biotech	96 Tests	EUR 571

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RD-ADAM17-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Hu-48Tests	Reddot Biotech	48 Tests	EUR 433

Human A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Hu-96Tests	Reddot Biotech	96 Tests	EUR 597

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat A Disintegrin And Metalloprotease 17 (ADAM17) ELISA Kit
RDR-ADAM17-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

ADAM17 antibody
70R-33352	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADAM17 antibody

ADAM17 antibody
70R-21435	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ADAM17 antibody

ADAM17 antibody
70R-31104	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADAM17 antibody

ADAM17 Antibody
36043-100ul	SAB	100ul	EUR 252

ADAM17 Antibody
49419-100ul	SAB	100ul	EUR 333

ADAM17 Antibody
49419-50ul	SAB	50ul	EUR 239

ADAM17 Antibody
1-CSB-PA001277GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ADAM17 Antibody
1-CSB-PA261035	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ADAM17 Antibody
1-CSB-PA050200	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAM17. Recognizes ADAM17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000

Polyclonal Goat Anti-ADAM17 / TACE Antibody
AMM04866G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ADAM17 / TACE . This antibody is tested and proven to work in the following applications:

Anti-ADAM17/Tace Rabbit Monoclonal Antibody
M00604	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal ADAM17/Tace Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human, Mouse, Rat.

ADAM17 Conjugated Antibody
C49419	SAB	100ul	EUR 397

ADAM17 Conjugated Antibody
C36043	SAB	100ul	EUR 397

ADAM17-Specific Antibody
abx230139-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

ADAM17 antibody (Thr735)
70R-33351	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADAM17 antibody (Thr735)

ADAM17 siRNA
20-abx900168	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADAM17 siRNA
20-abx906707	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADAM17 siRNA
20-abx906708	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cleaved-ADAM17 (R215) Antibody
1-CSB-PA050198	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-ADAM17 (R215). Recognizes Cleaved-ADAM17 (R215) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Phospho-ADAM17 (T735) Antibody
1-CSB-PA050199	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ADAM17 (T735). Recognizes Phospho-ADAM17 (T735) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Rabbit Anti-ADAM17 monoclonal antibody, clone KN21-46
DCABH-5885	Creative Diagnostics	100 ul	EUR 777

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

ADAM17 Rabbit pAb
A0821-100ul	Abclonal	100 ul	EUR 308

ADAM17 Rabbit pAb
A0821-200ul	Abclonal	200 ul	EUR 459

ADAM17 Rabbit pAb
A0821-20ul	Abclonal	20 ul	EUR 183

ADAM17 Rabbit pAb
A0821-50ul	Abclonal	50 ul	EUR 223

ADAM17 cloning plasmid
CSB-CL001277HU-10ug	Cusabio	10ug	EUR 286
Formulation: 10 μg plasmid + 200μl Glycerol Length: 630 Sequence: atgaggcagtctctcctattcctgaccagcgtggttcctttcgtgctggcgccgcgacctccggatgacccgggcttcggcccccaccagagactcgagaagcttgattctttgctctcagactacgatattctctctttatctaatatccagcagcattcggtaagaaaaagaga Show more
Description: A cloning plasmid for the ADAM17 gene.

Recombinant human ADAM17
P1442	FN Test	100ug	Ask for price
Uniprot ID: P78536 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human ADAM17

Recombinant Human ADAM17
P0557	FN Test	100ug	EUR 522.36
Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose Reconstitution: Sterile distilled water Purity: Greater than 95% by SDS-PAGE gel analyses Uniprot ID: P78536
Description: Recombinant Human protein for ADAM17

Polyclonal ADAM17 Antibody (C-term)
APG01551G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 Antibody (N-term)
APG01552G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 / TACE Antibody (aa807-823)
APG01548G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (aa807-823). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 / TACE Antibody (C-Terminus)
APG01549G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 / TACE Antibody (C-Terminus)
APG01550G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 / TACE (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal ADAM17 Antibody - C-terminal region
APG01553G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAM17 - C-terminal region. This antibody is tested and proven to work in the following applications:

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
20-abx000869	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx037459-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028423-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028423-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028424-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx028424-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx412493-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx430638-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

ADAM Metallopeptidase Domain 17 (ADAM17) Antibody
abx230138-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Rat ADAM17 shRNA Plasmid
20-abx985890	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ADAM17 ELISA Kit
ELA-E1319h	Lifescience Market	96 Tests	EUR 824

Mouse Adam17 ELISA KIT
ELI-04356m	Lifescience Market	96 Tests	EUR 865

Porcine ADAM17 ELISA KIT
ELI-04357p	Lifescience Market	96 Tests	EUR 928

Human ADAM17 ELISA KIT
ELI-04358h	Lifescience Market	96 Tests	EUR 824

Rat Adam17 ELISA KIT
ELI-04359r	Lifescience Market	96 Tests	EUR 886

ADAM17 ELISA KIT|Human
EF005263	Lifescience Market	96 Tests	EUR 689

Human ADAM17 shRNA Plasmid
20-abx954697	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ADAM17 shRNA Plasmid
20-abx969032	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ADAM17 Recombinant Protein (Rat)
RP189128	ABM	100 ug	Ask for price

ADAM17 Recombinant Protein (Mouse)
RP114179	ABM	100 ug	Ask for price

Recombinant Human ADAM17 Protein
VAng-2873Lsx-100g	Creative Biolabs	100 µg	EUR 3115
Description: Recombinant Human ADAM17 was expressed in Insect cell. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein
VAng-2873Lsx-1mg	Creative Biolabs	1 mg	EUR 17523
Description: Recombinant Human ADAM17 was expressed in Insect cell. (Uniprot ID: P78536)

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx130120	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx131773	Abbexa	EUR 300.00 EUR 704.00 EUR 356.00 EUR 154.00 EUR 244.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx110819	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx171029	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx103981	Abbexa	EUR 342.00 EUR 133.00 EUR 940.00 EUR 481.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx323786	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx326388	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx270145	Abbexa	EUR 467.00 EUR 537.00 EUR 272.00 EUR 815.00 EUR 356.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody
20-abx213698	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ADAM17 ORF Vector (Human) (pORF)
ORF000165	ABM	1.0 ug DNA	EUR 95

Adam17 ORF Vector (Mouse) (pORF)
ORF038061	ABM	1.0 ug DNA	EUR 95

Adam17 ORF Vector (Rat) (pORF)
ORF063044	ABM	1.0 ug DNA	EUR 506

ADAM17 ELISA Kit (Rat) (OKCD02296)
OKCD02296	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Responsible for the proteolytic release of several other cell-surface proteins, including p75 TNF-receptor, interleukin 1 receptor type II, p55 TNF-receptor, transforming growth factor-alpha, L-selectin, growth hormone receptor, MUC1 and the amyloid precursor protein. Acts as an activator of Notch pathway by mediating cleavage of Notch, generating the membrane-associated intermediate fragment called Notch extracellular truncation (NEXT). Plays a role in the proteolytic processing of ACE2. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

ADAM17 ELISA Kit (Human) (OKAN05578)
OKAN05578	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

ADAM17 ELISA Kit (Mouse) (OKCD02340)
OKCD02340	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Plays a role in the proteolytic processing of ACE2. Responsible for the proteolytic release of several other cell-surface proteins, including p75 TNF-receptor, interleukin 1 receptor type II, p55 TNF-receptor, transforming growth factor-alpha, L-selectin, growth hormone receptor, MUC1 and the amyloid precursor protein. Acts as an activator of Notch pathway by mediating cleavage of Notch, generating the membrane-associated intermediate fragment called notch extracellular truncation (NEXT).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

ADAM17 ELISA Kit (Mouse) (OKCA02169)
OKCA02169	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Cleaves the membrane-bound precursor of TNF-alpha to its mature soluble form. Responsible for the proteolytical release of soluble JAM3 from endothelial cells surface. Plays a role in the proteolytic processing of ACE2.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

ADAM17 ELISA Kit (Human) (OKCD07488)
OKCD07488	Aviva Systems Biology	96 Wells	EUR 635
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

ADAM17 ELISA Kit (Pig) (OKEH07915)
OKEH07915	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23pg/mL

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (FITC)
20-abx273695	Abbexa	EUR 398.00 EUR 230.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (FITC)
20-abx270443	Abbexa	EUR 523.00 EUR 606.00 EUR 300.00 EUR 940.00 EUR 384.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (APC)
20-abx270675	Abbexa	EUR 704.00 EUR 829.00 EUR 370.00 EUR 1330.00 EUR 495.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (PE)
20-abx270907	Abbexa	EUR 606.00 EUR 718.00 EUR 328.00 EUR 1135.00 EUR 439.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Antibody (Biotin)
20-abx272154	Abbexa	EUR 356.00 EUR 230.00 EUR 1024.00 EUR 509.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ADAM17 sgRNA CRISPR Lentivector set (Human)
K0042201	ABM	3 x 1.0 ug	EUR 339

Adam17 sgRNA CRISPR Lentivector set (Mouse)
K4825901	ABM	3 x 1.0 ug	EUR 339

Adam17 sgRNA CRISPR Lentivector set (Rat)
K7528901	ABM	3 x 1.0 ug	EUR 339

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human)
4-PAB555Hu01	Cloud-Clone	EUR 209.00 EUR 1929.00 EUR 493.00 EUR 257.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Lys226~Arg473) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17)

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat)
4-PAB555Ra01	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Leu221~Ser451) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17)

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human)
4-MAB555Hu22	Cloud-Clone	EUR 221.00 EUR 2114.00 EUR 535.00 EUR 274.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys226~Arg473 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17)

ADAM17 sgRNA CRISPR Lentivector (Human) (Target 1)
K0042202	ABM	1.0 ug DNA	EUR 154

ADAM17 sgRNA CRISPR Lentivector (Human) (Target 2)
K0042203	ABM	1.0 ug DNA	EUR 154

ADAM17 sgRNA CRISPR Lentivector (Human) (Target 3)
K0042204	ABM	1.0 ug DNA	EUR 154

Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4825902	ABM	1.0 ug DNA	EUR 154

Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4825903	ABM	1.0 ug DNA	EUR 154

Adam17 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4825904	ABM	1.0 ug DNA	EUR 154

Adam17 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7528902	ABM	1.0 ug DNA	EUR 154

Adam17 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7528903	ABM	1.0 ug DNA	EUR 154

Adam17 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7528904	ABM	1.0 ug DNA	EUR 154

ADAM17 Protein Vector (Human) (pPB-C-His)
PV000657	ABM	500 ng	EUR 329

ADAM17 Protein Vector (Human) (pPB-N-His)
PV000658	ABM	500 ng	EUR 329

ADAM17 Protein Vector (Human) (pPM-C-HA)
PV000659	ABM	500 ng	EUR 329

ADAM17 Protein Vector (Human) (pPM-C-His)
PV000660	ABM	500 ng	EUR 329

Recombinant A Disintegrin And Metalloprotease 17 (ADAM17)
4-RPB555Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78536 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.5kDa Isoelectric Point: Inquire
Description: Recombinant Human A Disintegrin And Metalloprotease 17 expressed in: E.coli

Recombinant A Disintegrin And Metalloprotease 17 (ADAM17)
4-RPB555Ra01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Z1K9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.6kDa Isoelectric Point: Inquire
Description: Recombinant Rat A Disintegrin And Metalloprotease 17 expressed in: E.coli

ADAM17 Protein Vector (Human) (pPB-His-MBP)
PV319734	ABM	500 ng	EUR 329

ADAM17 Protein Vector (Human) (pPB-His-GST)
PV319735	ABM	500 ng	EUR 329

ADAM17 Protein Vector (Mouse) (pPB-C-His)
PV152242	ABM	500 ng	EUR 1065

ADAM17 Protein Vector (Mouse) (pPB-N-His)
PV152243	ABM	500 ng	EUR 1065

ADAM17 Protein Vector (Mouse) (pPM-C-HA)
PV152244	ABM	500 ng	EUR 1065

ADAM17 Protein Vector (Mouse) (pPM-C-His)
PV152245	ABM	500 ng	EUR 1065

ADAM17 Protein Vector (Rat) (pPB-C-His)
PV252174	ABM	500 ng	EUR 1191

ADAM17 Protein Vector (Rat) (pPB-N-His)
PV252175	ABM	500 ng	EUR 1191

ADAM17 Protein Vector (Rat) (pPM-C-HA)
PV252176	ABM	500 ng	EUR 1191

ADAM17 Protein Vector (Rat) (pPM-C-His)
PV252177	ABM	500 ng	EUR 1191

Adam17 3'UTR Luciferase Stable Cell Line
TU200249	ABM	1.0 ml	Ask for price

Adam17 3'UTR GFP Stable Cell Line
TU151356	ABM	1.0 ml	Ask for price

ADAM17 3'UTR Luciferase Stable Cell Line
TU000301	ABM	1.0 ml	EUR 1521

Adam17 3'UTR Luciferase Stable Cell Line
TU101356	ABM	1.0 ml	Ask for price

ADAM17 3'UTR GFP Stable Cell Line
TU050301	ABM	1.0 ml	EUR 1521

Adam17 3'UTR GFP Stable Cell Line
TU250249	ABM	1.0 ml	Ask for price

Recombinant Pig ADAM17 Protein (aa 1-112)
VAng-2868Lsx-1mg	Creative Biolabs	1 mg	EUR 3103
Description: Recombinant Pig ADAM17 was expressed in E. coli. (Uniprot ID: O77636)

Recombinant Pig ADAM17 Protein (aa 1-112)
VAng-2868Lsx-200g	Creative Biolabs	200 µg	EUR 1906
Description: Recombinant Pig ADAM17 was expressed in E. coli. (Uniprot ID: O77636)

Recombinant Pig ADAM17 Protein (aa 1-112)
VAng-2868Lsx-500g	Creative Biolabs	500 µg	EUR 2099
Description: Recombinant Pig ADAM17 was expressed in E. coli. (Uniprot ID: O77636)

Recombinant Human ADAM17 Protein (aa 215-824)
VAng-2869Lsx-100g	Creative Biolabs	100 µg	EUR 7419
Description: Recombinant Human ADAM17 was expressed in cell free expression systems. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-824)
VAng-2869Lsx-50g	Creative Biolabs	50 µg	EUR 4917
Description: Recombinant Human ADAM17 was expressed in cell free expression systems. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-671)
VAng-2870Lsx-1mg	Creative Biolabs	1 mg	EUR 5095
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-671)
VAng-2870Lsx-200g	Creative Biolabs	200 µg	EUR 3268
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 215-671)
VAng-2870Lsx-500g	Creative Biolabs	500 µg	EUR 3597
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 226-473)
VAng-2872Lsx-1mg	Creative Biolabs	1 mg	EUR 3940
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 226-473)
VAng-2872Lsx-200g	Creative Biolabs	200 µg	EUR 1411
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

Recombinant Human ADAM17 Protein (aa 226-473)
VAng-2872Lsx-500g	Creative Biolabs	500 µg	EUR 2675
Description: Recombinant Human ADAM17 was expressed in E. coli. (Uniprot ID: P78536)

ADAM17 ELISA Kit (Human) : 96 Wells (OKEH00945)
OKEH00945	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. [provided by RefSeq, Feb 2016];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

A Disintegrin And Metalloprotease 17 Phospho-Thr735 (ADAM17 pT735) Antibody
20-abx328562	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), APC
4-PAB555Hu01-APC	Cloud-Clone	EUR 289.00 EUR 2483.00 EUR 714.00 EUR 360.00 EUR 196.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Lys226~Arg473) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with APC.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), Biotinylated
4-PAB555Hu01-Biotin	Cloud-Clone	EUR 270.00 EUR 1879.00 EUR 582.00 EUR 322.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Lys226~Arg473) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Biotin.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), Cy3
4-PAB555Hu01-Cy3	Cloud-Clone	EUR 344.00 EUR 3269.00 EUR 911.00 EUR 439.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Lys226~Arg473) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Cy3.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), FITC
4-PAB555Hu01-FITC	Cloud-Clone	EUR 251.00 EUR 2006.00 EUR 591.00 EUR 308.00 EUR 176.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Lys226~Arg473) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with FITC.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), HRP
4-PAB555Hu01-HRP	Cloud-Clone	EUR 267.00 EUR 2168.00 EUR 635.00 EUR 329.00 EUR 186.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Lys226~Arg473) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with HRP.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Human), PE
4-PAB555Hu01-PE	Cloud-Clone	EUR 251.00 EUR 2006.00 EUR 591.00 EUR 308.00 EUR 176.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Lys226~Arg473) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with PE.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), APC
4-PAB555Ra01-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Leu221~Ser451) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with APC.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), Biotinylated
4-PAB555Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Leu221~Ser451) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Biotin.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), Cy3
4-PAB555Ra01-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Leu221~Ser451) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Cy3.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), FITC
4-PAB555Ra01-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Leu221~Ser451) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with FITC.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), HRP
4-PAB555Ra01-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Leu221~Ser451) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with HRP.

A Disintegrin And Metalloprotease 17 (ADAM17) Polyclonal Antibody (Rat), PE
4-PAB555Ra01-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ADAM17 (Leu221~Ser451) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with PE.

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), APC
4-MAB555Hu22-APC	Cloud-Clone	EUR 307.00 EUR 2735.00 EUR 777.00 EUR 386.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys226~Arg473 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with APC.

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), Biotinylated
4-MAB555Hu22-Biotin	Cloud-Clone	EUR 283.00 EUR 2064.00 EUR 628.00 EUR 341.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys226~Arg473 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Biotin.

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), Cy3
4-MAB555Hu22-Cy3	Cloud-Clone	EUR 368.00 EUR 3605.00 EUR 995.00 EUR 473.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys226~Arg473 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with Cy3.

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), FITC
4-MAB555Hu22-FITC	Cloud-Clone	EUR 266.00 EUR 2208.00 EUR 642.00 EUR 328.00 EUR 182.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys226~Arg473 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with FITC.

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), HRP
4-MAB555Hu22-HRP	Cloud-Clone	EUR 283.00 EUR 2387.00 EUR 690.00 EUR 351.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys226~Arg473 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with HRP.

A Disintegrin And Metalloprotease 17 (ADAM17) Monoclonal Antibody (Human), PE
4-MAB555Hu22-PE	Cloud-Clone	EUR 266.00 EUR 2208.00 EUR 642.00 EUR 328.00 EUR 182.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Lys226~Arg473 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human A Disintegrin And Metalloprotease 17 (ADAM17). This antibody is labeled with PE.

Mouse ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx516367-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Pig ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx516368-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx361925-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx363208-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human ADAM Metallopeptidase Domain 17 (ADAM17) ELISA Kit
abx570602-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

anti-ADAM17 antibody